Incidental Mutation 'R1734:Aimp1'
ID199554
Institutional Source Beutler Lab
Gene Symbol Aimp1
Ensembl Gene ENSMUSG00000028029
Gene Nameaminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Synonyms9830137A06Rik, AIMP1/p43, Scye1, Emap2, EMAPII
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.723) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location132660499-132684370 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 132674796 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 59 (I59K)
Ref Sequence ENSEMBL: ENSMUSP00000142534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029663] [ENSMUST00000196206] [ENSMUST00000196963] [ENSMUST00000197793] [ENSMUST00000198513]
Predicted Effect probably damaging
Transcript: ENSMUST00000029663
AA Change: I68K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029663
Gene: ENSMUSG00000028029
AA Change: I68K

DomainStartEndE-ValueType
coiled coil region 17 84 N/A INTRINSIC
low complexity region 124 144 N/A INTRINSIC
Pfam:tRNA_bind 164 257 2.9e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196206
AA Change: I59K

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142914
Gene: ENSMUSG00000028029
AA Change: I59K

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197646
Predicted Effect probably damaging
Transcript: ENSMUST00000197793
AA Change: I59K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142534
Gene: ENSMUSG00000028029
AA Change: I59K

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198513
AA Change: I59K

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142513
Gene: ENSMUSG00000028029
AA Change: I59K

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200025
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that is specifically induced by apoptosis, and it is involved in the control of angiogenesis, inflammation, and wound healing. The release of this cytokine renders the tumor-associated vasculature sensitive to tumor necrosis factor. The precursor protein is identical to the p43 subunit, which is associated with the multi-tRNA synthetase complex, and it modulates aminoacylation activity of tRNA synthetase in normal cells. This protein is also involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display delayed wound healing and decreased inflammatory response after wounding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Aimp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Aimp1 APN 3 132677143 splice site probably benign
IGL00742:Aimp1 APN 3 132671981 nonsense probably null
IGL01863:Aimp1 APN 3 132672092 missense probably benign 0.03
IGL02432:Aimp1 APN 3 132673977 missense probably benign
R0305:Aimp1 UTSW 3 132673986 missense possibly damaging 0.89
R0699:Aimp1 UTSW 3 132674865 splice site probably benign
R1793:Aimp1 UTSW 3 132674064 missense probably benign 0.21
R1975:Aimp1 UTSW 3 132677099 missense possibly damaging 0.81
R2010:Aimp1 UTSW 3 132667492 missense probably benign 0.01
R4424:Aimp1 UTSW 3 132667492 missense probably benign 0.01
R4583:Aimp1 UTSW 3 132677047 missense probably damaging 0.99
R6135:Aimp1 UTSW 3 132672083 missense probably benign 0.30
R6285:Aimp1 UTSW 3 132667504 missense possibly damaging 0.81
R7270:Aimp1 UTSW 3 132677011 missense probably damaging 1.00
R7662:Aimp1 UTSW 3 132674066 missense probably benign 0.00
X0057:Aimp1 UTSW 3 132677112 start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTCACCTCACATGGACCGC -3'
(R):5'- GTGAGAGTCCTATACCCAATGTCCCAA -3'

Sequencing Primer
(F):5'- TGGCTTGGGTAACAAAAGTCC -3'
(R):5'- GGCCAAATATTCGTTTCTGTCAC -3'
Posted On2014-05-23