Incidental Mutation 'R1734:Aimp1'
ID 199554
Institutional Source Beutler Lab
Gene Symbol Aimp1
Ensembl Gene ENSMUSG00000028029
Gene Name aminoacyl tRNA synthetase complex-interacting multifunctional protein 1
Synonyms Scye1, Emap2, EMAPII, 9830137A06Rik, AIMP1/p43
MMRRC Submission 039766-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.863) question?
Stock # R1734 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 132366242-132390131 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 132380557 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 59 (I59K)
Ref Sequence ENSEMBL: ENSMUSP00000142534 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029663] [ENSMUST00000196206] [ENSMUST00000196963] [ENSMUST00000197793] [ENSMUST00000198513]
AlphaFold P31230
Predicted Effect probably damaging
Transcript: ENSMUST00000029663
AA Change: I68K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000029663
Gene: ENSMUSG00000028029
AA Change: I68K

DomainStartEndE-ValueType
coiled coil region 17 84 N/A INTRINSIC
low complexity region 124 144 N/A INTRINSIC
Pfam:tRNA_bind 164 257 2.9e-34 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000196206
AA Change: I59K

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142914
Gene: ENSMUSG00000028029
AA Change: I59K

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197646
Predicted Effect probably damaging
Transcript: ENSMUST00000197793
AA Change: I59K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142534
Gene: ENSMUSG00000028029
AA Change: I59K

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198513
AA Change: I59K

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000142513
Gene: ENSMUSG00000028029
AA Change: I59K

DomainStartEndE-ValueType
coiled coil region 8 75 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200025
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that is specifically induced by apoptosis, and it is involved in the control of angiogenesis, inflammation, and wound healing. The release of this cytokine renders the tumor-associated vasculature sensitive to tumor necrosis factor. The precursor protein is identical to the p43 subunit, which is associated with the multi-tRNA synthetase complex, and it modulates aminoacylation activity of tRNA synthetase in normal cells. This protein is also involved in the stimulation of inflammatory responses after proteolytic cleavage in tumor cells. Multiple transcript variants encoding different isoforms have been found for this gene. A pseudogene has been identified on chromosome 20. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mice homozygous for a gene trap allele display delayed wound healing and decreased inflammatory response after wounding. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A T 4: 144,396,596 (GRCm39) C379S probably benign Het
Abca13 T C 11: 9,535,460 (GRCm39) C4695R probably benign Het
Actr10 T A 12: 71,008,770 (GRCm39) V401E probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Alms1 T A 6: 85,618,532 (GRCm39) probably null Het
Anln A T 9: 22,262,251 (GRCm39) S947T possibly damaging Het
Atp2c1 T C 9: 105,291,854 (GRCm39) T733A probably damaging Het
BC049715 C T 6: 136,817,306 (GRCm39) P182L probably damaging Het
Cblb T C 16: 52,006,603 (GRCm39) probably benign Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Chac1 A T 2: 119,183,939 (GRCm39) L180F probably damaging Het
Cherp A T 8: 73,223,932 (GRCm39) probably null Het
Ckap4 A G 10: 84,363,738 (GRCm39) S442P probably benign Het
Clstn3 G A 6: 124,413,773 (GRCm39) probably benign Het
Crb2 T A 2: 37,683,668 (GRCm39) C1057S probably damaging Het
Dact2 T C 17: 14,416,901 (GRCm39) D433G probably benign Het
Dnah6 G A 6: 73,021,744 (GRCm39) T3526M probably damaging Het
Ethe1 A G 7: 24,307,809 (GRCm39) T210A probably benign Het
Fat2 A G 11: 55,172,197 (GRCm39) S2839P probably benign Het
Fbxl7 T C 15: 26,543,735 (GRCm39) Y304C probably damaging Het
Gad1-ps A T 10: 99,281,637 (GRCm39) noncoding transcript Het
Grm3 C T 5: 9,639,742 (GRCm39) R101K probably benign Het
Hspa12b A G 2: 130,980,456 (GRCm39) Y125C possibly damaging Het
Il10ra T C 9: 45,167,241 (GRCm39) T437A probably benign Het
Itprid2 G A 2: 79,488,166 (GRCm39) V750M probably damaging Het
Jcad T C 18: 4,674,526 (GRCm39) F763L probably damaging Het
Map3k10 T C 7: 27,357,540 (GRCm39) D746G probably damaging Het
Mettl9 T A 7: 120,647,064 (GRCm39) Y57N probably damaging Het
Nav2 G A 7: 49,225,468 (GRCm39) E1803K probably damaging Het
Nol11 G A 11: 107,066,449 (GRCm39) S447L possibly damaging Het
Or14a256 C T 7: 86,265,425 (GRCm39) V143M probably benign Het
Osbpl1a T C 18: 12,921,373 (GRCm39) probably null Het
Pde6a A G 18: 61,419,036 (GRCm39) N804S probably damaging Het
Pepd A T 7: 34,730,851 (GRCm39) D301V probably benign Het
Piwil2 A T 14: 70,663,954 (GRCm39) probably null Het
Plec C T 15: 76,070,418 (GRCm39) V931M probably damaging Het
Prrc2a A G 17: 35,369,683 (GRCm39) S1877P possibly damaging Het
Retreg2 G T 1: 75,119,630 (GRCm39) probably null Het
Slc7a11 G A 3: 50,326,795 (GRCm39) Q489* probably null Het
Sned1 G A 1: 93,187,490 (GRCm39) D256N probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Spmip9 T A 6: 70,890,645 (GRCm39) Q49L probably benign Het
Syce2 G A 8: 85,613,776 (GRCm39) E168K probably benign Het
Tmem260 G T 14: 48,746,550 (GRCm39) V609L probably benign Het
Trim35 A G 14: 66,546,778 (GRCm39) D515G probably damaging Het
Tspan5 T C 3: 138,603,901 (GRCm39) Y131H probably damaging Het
Ttbk2 T C 2: 120,586,319 (GRCm39) I466V probably benign Het
Ttn T C 2: 76,576,157 (GRCm39) D24912G probably damaging Het
Utp20 A T 10: 88,603,323 (GRCm39) N1843K probably damaging Het
Vmn1r20 A G 6: 57,409,285 (GRCm39) R204G probably damaging Het
Vps18 A T 2: 119,124,423 (GRCm39) Q450L probably benign Het
Zbtb4 A G 11: 69,667,289 (GRCm39) E198G probably benign Het
Other mutations in Aimp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Aimp1 APN 3 132,382,904 (GRCm39) splice site probably benign
IGL00742:Aimp1 APN 3 132,377,742 (GRCm39) nonsense probably null
IGL01863:Aimp1 APN 3 132,377,853 (GRCm39) missense probably benign 0.03
IGL02432:Aimp1 APN 3 132,379,738 (GRCm39) missense probably benign
R0305:Aimp1 UTSW 3 132,379,747 (GRCm39) missense possibly damaging 0.89
R0699:Aimp1 UTSW 3 132,380,626 (GRCm39) splice site probably benign
R1793:Aimp1 UTSW 3 132,379,825 (GRCm39) missense probably benign 0.21
R1975:Aimp1 UTSW 3 132,382,860 (GRCm39) missense possibly damaging 0.81
R2010:Aimp1 UTSW 3 132,373,253 (GRCm39) missense probably benign 0.01
R4424:Aimp1 UTSW 3 132,373,253 (GRCm39) missense probably benign 0.01
R4583:Aimp1 UTSW 3 132,382,808 (GRCm39) missense probably damaging 0.99
R6135:Aimp1 UTSW 3 132,377,844 (GRCm39) missense probably benign 0.30
R6285:Aimp1 UTSW 3 132,373,265 (GRCm39) missense possibly damaging 0.81
R7270:Aimp1 UTSW 3 132,382,772 (GRCm39) missense probably damaging 1.00
R7662:Aimp1 UTSW 3 132,379,827 (GRCm39) missense probably benign 0.00
R8782:Aimp1 UTSW 3 132,373,242 (GRCm39) missense possibly damaging 0.49
X0057:Aimp1 UTSW 3 132,382,873 (GRCm39) start codon destroyed probably null 1.00
Predicted Primers PCR Primer
(F):5'- AAGTTCACCTCACATGGACCGC -3'
(R):5'- GTGAGAGTCCTATACCCAATGTCCCAA -3'

Sequencing Primer
(F):5'- TGGCTTGGGTAACAAAAGTCC -3'
(R):5'- GGCCAAATATTCGTTTCTGTCAC -3'
Posted On 2014-05-23