Incidental Mutation 'R1734:Grm3'
ID199559
Institutional Source Beutler Lab
Gene Symbol Grm3
Ensembl Gene ENSMUSG00000003974
Gene Nameglutamate receptor, metabotropic 3
SynonymsGprc1c, mGlu3, mGluR3, 0710001G23Rik
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location9485541-9725170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 9589742 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 101 (R101K)
Ref Sequence ENSEMBL: ENSMUSP00000004076 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004076]
Predicted Effect probably benign
Transcript: ENSMUST00000004076
AA Change: R101K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000004076
Gene: ENSMUSG00000003974
AA Change: R101K

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 67 473 4.8e-102 PFAM
Pfam:NCD3G 505 555 2.4e-14 PFAM
Pfam:7tm_3 588 825 4.7e-62 PFAM
low complexity region 849 861 N/A INTRINSIC
Meta Mutation Damage Score 0.0654 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted mutation display normal morphology, clinical chemistry, hematology, and behavior. Mice homozygous for a knock-out allele exhibit altered neuroprotection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Grm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Grm3 APN 5 9512290 missense probably benign
IGL01393:Grm3 APN 5 9589856 missense probably benign 0.00
IGL01398:Grm3 APN 5 9485762 unclassified probably benign
IGL01825:Grm3 APN 5 9511600 missense probably damaging 1.00
IGL01966:Grm3 APN 5 9511486 missense probably damaging 0.98
IGL02367:Grm3 APN 5 9511660 missense probably damaging 1.00
IGL02526:Grm3 APN 5 9589847 missense probably damaging 1.00
IGL02972:Grm3 APN 5 9512410 missense probably damaging 1.00
IGL03356:Grm3 APN 5 9512206 missense possibly damaging 0.89
BB002:Grm3 UTSW 5 9589880 missense probably benign 0.09
BB012:Grm3 UTSW 5 9589880 missense probably benign 0.09
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0032:Grm3 UTSW 5 9511452 splice site probably null
R0389:Grm3 UTSW 5 9504794 missense probably damaging 1.00
R0455:Grm3 UTSW 5 9512477 missense probably benign
R0538:Grm3 UTSW 5 9512446 missense possibly damaging 0.95
R0553:Grm3 UTSW 5 9570048 missense probably benign 0.16
R1124:Grm3 UTSW 5 9570297 missense probably benign
R1163:Grm3 UTSW 5 9570738 missense probably benign 0.34
R1440:Grm3 UTSW 5 9589958 missense probably benign
R1635:Grm3 UTSW 5 9511520 missense probably damaging 1.00
R1895:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R1926:Grm3 UTSW 5 9504881 missense probably damaging 0.98
R1940:Grm3 UTSW 5 9511682 missense probably damaging 1.00
R1946:Grm3 UTSW 5 9512123 missense probably damaging 1.00
R2004:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2005:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R2006:Grm3 UTSW 5 9589793 missense possibly damaging 0.57
R3116:Grm3 UTSW 5 9570752 missense probably damaging 1.00
R4083:Grm3 UTSW 5 9512054 missense probably benign
R4537:Grm3 UTSW 5 9512083 missense probably benign 0.02
R4855:Grm3 UTSW 5 9570047 missense probably damaging 0.98
R5060:Grm3 UTSW 5 9570167 missense probably damaging 0.99
R5093:Grm3 UTSW 5 9589766 missense probably benign 0.01
R5419:Grm3 UTSW 5 9570233 missense probably damaging 1.00
R5525:Grm3 UTSW 5 9504872 missense probably damaging 1.00
R5642:Grm3 UTSW 5 9570536 missense probably benign 0.21
R5804:Grm3 UTSW 5 9570155 missense probably benign 0.33
R5915:Grm3 UTSW 5 9511927 missense probably damaging 1.00
R5966:Grm3 UTSW 5 9511930 missense probably damaging 0.98
R6151:Grm3 UTSW 5 9511556 missense probably damaging 1.00
R6419:Grm3 UTSW 5 9570201 missense probably damaging 1.00
R7267:Grm3 UTSW 5 9589581 missense probably benign 0.00
R7555:Grm3 UTSW 5 9570000 missense probably benign 0.00
R7657:Grm3 UTSW 5 9511452 splice site probably null
R7925:Grm3 UTSW 5 9589880 missense probably benign 0.09
R8032:Grm3 UTSW 5 9512272 missense probably benign 0.11
R8227:Grm3 UTSW 5 9570242 missense possibly damaging 0.65
X0020:Grm3 UTSW 5 9512195 missense probably damaging 1.00
X0025:Grm3 UTSW 5 9485790 missense probably damaging 1.00
X0026:Grm3 UTSW 5 9512238 nonsense probably null
Z1088:Grm3 UTSW 5 9570183 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTACGAACCGCCAATGACTCC -3'
(R):5'- GTGACGGGCTCTTTTAGCCCTATC -3'

Sequencing Primer
(F):5'- CAATGACTCCTGCAATGAGTAGTG -3'
(R):5'- ATCCTCCCTTATCTGAAGGACAG -3'
Posted On2014-05-23