Incidental Mutation 'R1734:Tex37'
ID199561
Institutional Source Beutler Lab
Gene Symbol Tex37
Ensembl Gene ENSMUSG00000051896
Gene Nametestis expressed 37
Synonyms
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location70913087-70918927 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 70913661 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 49 (Q49L)
Ref Sequence ENSEMBL: ENSMUSP00000066786 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063456]
Predicted Effect probably benign
Transcript: ENSMUST00000063456
AA Change: Q49L

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000066786
Gene: ENSMUSG00000051896
AA Change: Q49L

DomainStartEndE-ValueType
Pfam:TSC21 1 180 4.3e-107 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Tex37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Tex37 APN 6 70913388 missense probably benign 0.12
IGL02323:Tex37 APN 6 70913695 splice site probably benign
IGL02693:Tex37 APN 6 70913504 missense possibly damaging 0.71
IGL03161:Tex37 APN 6 70913535 missense probably benign 0.08
R3408:Tex37 UTSW 6 70915706 missense possibly damaging 0.52
R3956:Tex37 UTSW 6 70913485 missense possibly damaging 0.93
R3981:Tex37 UTSW 6 70913299 missense possibly damaging 0.71
R5084:Tex37 UTSW 6 70915704 missense possibly damaging 0.86
R5376:Tex37 UTSW 6 70913482 missense possibly damaging 0.84
R7532:Tex37 UTSW 6 70913637 missense probably benign 0.37
R8317:Tex37 UTSW 6 70913292 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- GTAAGCATAATGGCAGGTGGTGGTAA -3'
(R):5'- GCACAGGACCATCCTCTCCCAG -3'

Sequencing Primer
(F):5'- GTGGTAAACCTGCCGTCATC -3'
(R):5'- AAATGTTTTGGGTGctgggtc -3'
Posted On2014-05-23