Mutagenetix > Incidental Mutation

Incidental Mutation 'R1734:Clstn3'

199564

Institutional Source

Beutler Lab

Gene Symbol

Clstn3

Ensembl Gene

ENSMUSG00000008153

Gene Name

calsyntenin 3

Synonyms

alcadein-beta, Cst-3, CSTN3

MMRRC Submission

039766-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1734 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

124430759-124464794 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to A at 124436814 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000108142 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523]

AlphaFold

Q99JH7

Predicted Effect

probably benign
Transcript: ENSMUST00000008297

SMART Domains

Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
CA	50	143	2.72e-12	SMART
CA	166	244	4.04e-2	SMART
SCOP:d1a8d_1	333	549	7e-23	SMART
transmembrane domain	846	868	N/A	INTRINSIC
low complexity region	928	945	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000112523

SMART Domains

Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153

Domain	Start	End	E-Value	Type
CA	13	106	2.72e-12	SMART
CA	129	207	4.04e-2	SMART
Pfam:Laminin_G_3	304	505	4.1e-8	PFAM
transmembrane domain	809	831	N/A	INTRINSIC
low complexity region	891	908	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000124998

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143283

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147947

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 92.9%

Validation Efficiency

98% (59/60)

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,585,460	C4695R	probably benign	Het
Actr10	T	A	12: 70,961,996	V401E	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Aimp1	A	T	3: 132,674,796	I59K	probably damaging	Het
Alms1	T	A	6: 85,641,550		probably null	Het
Anln	A	T	9: 22,350,955	S947T	possibly damaging	Het
Atp2c1	T	C	9: 105,414,655	T733A	probably damaging	Het
BC049715	C	T	6: 136,840,308	P182L	probably damaging	Het
Cblb	T	C	16: 52,186,240		probably benign	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Chac1	A	T	2: 119,353,458	L180F	probably damaging	Het
Cherp	A	T	8: 72,470,088		probably null	Het
Ckap4	A	G	10: 84,527,874	S442P	probably benign	Het
Crb2	T	A	2: 37,793,656	C1057S	probably damaging	Het
Dact2	T	C	17: 14,196,639	D433G	probably benign	Het
Dnah6	G	A	6: 73,044,761	T3526M	probably damaging	Het
Ethe1	A	G	7: 24,608,384	T210A	probably benign	Het
Fat2	A	G	11: 55,281,371	S2839P	probably benign	Het
Fbxl7	T	C	15: 26,543,649	Y304C	probably damaging	Het
Gad1-ps	A	T	10: 99,445,775		noncoding transcript	Het
Gm436	A	T	4: 144,670,026	C379S	probably benign	Het
Grm3	C	T	5: 9,589,742	R101K	probably benign	Het
Hspa12b	A	G	2: 131,138,536	Y125C	possibly damaging	Het
Il10ra	T	C	9: 45,255,943	T437A	probably benign	Het
Jcad	T	C	18: 4,674,526	F763L	probably damaging	Het
Map3k10	T	C	7: 27,658,115	D746G	probably damaging	Het
Mettl9	T	A	7: 121,047,841	Y57N	probably damaging	Het
Nav2	G	A	7: 49,575,720	E1803K	probably damaging	Het
Nol11	G	A	11: 107,175,623	S447L	possibly damaging	Het
Olfr294	C	T	7: 86,616,217	V143M	probably benign	Het
Osbpl1a	T	C	18: 12,788,316		probably null	Het
Pde6a	A	G	18: 61,285,965	N804S	probably damaging	Het
Pepd	A	T	7: 35,031,426	D301V	probably benign	Het
Piwil2	A	T	14: 70,426,505		probably null	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Prrc2a	A	G	17: 35,150,707	S1877P	possibly damaging	Het
Retreg2	G	T	1: 75,142,986		probably null	Het
Slc7a11	G	A	3: 50,372,346	Q489*	probably null	Het
Sned1	G	A	1: 93,259,768	D256N	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Ssfa2	G	A	2: 79,657,822	V750M	probably damaging	Het
Syce2	G	A	8: 84,887,147	E168K	probably benign	Het
Tex37	T	A	6: 70,913,661	Q49L	probably benign	Het
Tmem260	G	T	14: 48,509,093	V609L	probably benign	Het
Trim35	A	G	14: 66,309,329	D515G	probably damaging	Het
Tspan5	T	C	3: 138,898,140	Y131H	probably damaging	Het
Ttbk2	T	C	2: 120,755,838	I466V	probably benign	Het
Ttn	T	C	2: 76,745,813	D24912G	probably damaging	Het
Utp20	A	T	10: 88,767,461	N1843K	probably damaging	Het
Vmn1r20	A	G	6: 57,432,300	R204G	probably damaging	Het
Vps18	A	T	2: 119,293,942	Q450L	probably benign	Het
Zbtb4	A	G	11: 69,776,463	E198G	probably benign	Het

Other mutations in Clstn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Clstn3	APN	6	124462139	missense	probably damaging	1.00
IGL01415:Clstn3	APN	6	124438822	nonsense	probably null
IGL01521:Clstn3	APN	6	124458031	nonsense	probably null
IGL01537:Clstn3	APN	6	124431600	missense	possibly damaging	0.91
IGL01729:Clstn3	APN	6	124449794	missense	probably benign	0.06
IGL01879:Clstn3	APN	6	124438810	missense	probably damaging	1.00
IGL01998:Clstn3	APN	6	124458663	missense	probably damaging	1.00
IGL03130:Clstn3	APN	6	124459263	missense	probably damaging	0.98
IGL03405:Clstn3	APN	6	124438368	missense	possibly damaging	0.95
PIT4403001:Clstn3	UTSW	6	124458023	missense	probably damaging	1.00
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0049:Clstn3	UTSW	6	124459853	missense	possibly damaging	0.87
R0208:Clstn3	UTSW	6	124432169	splice site	probably benign
R0276:Clstn3	UTSW	6	124431740	splice site	probably benign
R0440:Clstn3	UTSW	6	124451413	missense	probably damaging	1.00
R0612:Clstn3	UTSW	6	124449500	missense	probably damaging	0.98
R1200:Clstn3	UTSW	6	124459170	missense	probably damaging	1.00
R1224:Clstn3	UTSW	6	124457919	missense	probably benign
R1378:Clstn3	UTSW	6	124438419	missense	probably damaging	1.00
R1491:Clstn3	UTSW	6	124437490	missense	possibly damaging	0.51
R1495:Clstn3	UTSW	6	124449917	missense	probably benign	0.00
R1511:Clstn3	UTSW	6	124462169	missense	probably damaging	1.00
R1655:Clstn3	UTSW	6	124437427	missense	probably damaging	1.00
R1731:Clstn3	UTSW	6	124431632	missense	probably benign	0.04
R1751:Clstn3	UTSW	6	124431999	missense	probably damaging	1.00
R1954:Clstn3	UTSW	6	124459298	missense	possibly damaging	0.94
R2133:Clstn3	UTSW	6	124449503	missense	probably benign
R2192:Clstn3	UTSW	6	124459207	missense	probably damaging	1.00
R2314:Clstn3	UTSW	6	124450717	missense	probably benign	0.39
R2874:Clstn3	UTSW	6	124438335	missense	probably damaging	1.00
R3500:Clstn3	UTSW	6	124431711	missense	probably benign	0.01
R3761:Clstn3	UTSW	6	124457876	missense	possibly damaging	0.54
R3878:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3927:Clstn3	UTSW	6	124451368	missense	probably damaging	1.00
R3934:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R3935:Clstn3	UTSW	6	124457942	missense	probably damaging	0.97
R4063:Clstn3	UTSW	6	124449833	missense	possibly damaging	0.51
R4402:Clstn3	UTSW	6	124456980	missense	probably damaging	0.96
R4534:Clstn3	UTSW	6	124459220	missense	probably damaging	1.00
R4785:Clstn3	UTSW	6	124437372	splice site	probably null
R4834:Clstn3	UTSW	6	124431953	splice site	probably null
R5921:Clstn3	UTSW	6	124431580	utr 3 prime	probably benign
R5932:Clstn3	UTSW	6	124438332	missense	probably benign	0.01
R6025:Clstn3	UTSW	6	124431664	missense	possibly damaging	0.73
R6101:Clstn3	UTSW	6	124461670	missense	probably damaging	1.00
R6360:Clstn3	UTSW	6	124438429	missense	possibly damaging	0.88
R6578:Clstn3	UTSW	6	124450704	critical splice donor site	probably null
R6813:Clstn3	UTSW	6	124436935	missense	probably benign	0.00
R7380:Clstn3	UTSW	6	124456989	missense	probably benign	0.01
R7419:Clstn3	UTSW	6	124458129	missense	probably benign	0.05
R7625:Clstn3	UTSW	6	124437418	nonsense	probably null
R7780:Clstn3	UTSW	6	124462202	missense	probably damaging	0.98
R7936:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R7939:Clstn3	UTSW	6	124462199	missense	probably damaging	1.00
R8047:Clstn3	UTSW	6	124432013	missense	possibly damaging	0.73
R8079:Clstn3	UTSW	6	124459804	missense	probably damaging	1.00
R8085:Clstn3	UTSW	6	124458724	missense	probably benign	0.23
R8299:Clstn3	UTSW	6	124437373	critical splice donor site	probably null
R8406:Clstn3	UTSW	6	124462177	missense	probably damaging	1.00
R8685:Clstn3	UTSW	6	124456908	missense	probably damaging	1.00
R9045:Clstn3	UTSW	6	124431962	missense	probably damaging	0.98
R9209:Clstn3	UTSW	6	124431612	missense	probably benign	0.02
R9264:Clstn3	UTSW	6	124459768	missense	probably damaging	1.00
R9268:Clstn3	UTSW	6	124456921	missense	probably damaging	0.99
R9443:Clstn3	UTSW	6	124451399	missense	probably damaging	1.00
RF014:Clstn3	UTSW	6	124459266	nonsense	probably null
X0066:Clstn3	UTSW	6	124449811	missense	probably benign	0.13
Z1176:Clstn3	UTSW	6	124459200	missense	probably damaging	1.00
Z1177:Clstn3	UTSW	6	124449781	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CACCTTCCCAGTGAAGTTGAGGATG -3'
(R):5'- GCCCATTGTGTTATGAGTCCTACCC -3'

Sequencing Primer
(F):5'- GATGAAGCGATTGTCCCACC -3'
(R):5'- GTGTTATGAGTCCTACCCCAAGTTAG -3'

Posted On

2014-05-23