Incidental Mutation 'R1734:Ethe1'
ID199566
Institutional Source Beutler Lab
Gene Symbol Ethe1
Ensembl Gene ENSMUSG00000064254
Gene Nameethylmalonic encephalopathy 1
Synonyms
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.395) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24587543-24608925 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24608384 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 210 (T210A)
Ref Sequence ENSEMBL: ENSMUSP00000076433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073325] [ENSMUST00000077191] [ENSMUST00000206422]
Predicted Effect probably benign
Transcript: ENSMUST00000073325
SMART Domains Protein: ENSMUSP00000073047
Gene: ENSMUSG00000074277

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
low complexity region 61 74 N/A INTRINSIC
coiled coil region 111 302 N/A INTRINSIC
low complexity region 364 374 N/A INTRINSIC
Blast:PH 389 447 2e-29 BLAST
Blast:PH 457 488 4e-6 BLAST
low complexity region 490 514 N/A INTRINSIC
PH 541 645 1.54e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000077191
AA Change: T210A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000076433
Gene: ENSMUSG00000064254
AA Change: T210A

DomainStartEndE-ValueType
Lactamase_B 34 195 1.05e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000206422
Meta Mutation Damage Score 0.0581 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the metallo beta-lactamase family of iron-containing proteins involved in the mitochondrial sulfide oxidation pathway. The encoded protein catalyzes the oxidation of a persulfide substrate to sulfite. Certain mutations in this gene cause ethylmalonic encephalopathy, an infantile metabolic disorder affecting the brain, gastrointestinal tract and peripheral vessels. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Mar 2016]
PHENOTYPE: Mice homozygous for a null mutation display premature death with elevated levels of hydrogen sulfide and thiosulfates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Ethe1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01779:Ethe1 APN 7 24595009 missense probably damaging 1.00
R0565:Ethe1 UTSW 7 24607889 missense probably benign 0.00
R1757:Ethe1 UTSW 7 24608474 unclassified probably benign
R1774:Ethe1 UTSW 7 24593946 missense probably benign 0.01
R4662:Ethe1 UTSW 7 24593980 missense probably benign 0.00
R4676:Ethe1 UTSW 7 24607894 missense probably damaging 1.00
R7286:Ethe1 UTSW 7 24607952 missense probably damaging 1.00
R7424:Ethe1 UTSW 7 24606251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGGACACCTTCTCTGGACCATTC -3'
(R):5'- CCACAGCGCATATTTGCAGGAAC -3'

Sequencing Primer
(F):5'- TTCAGGGAAGGGCCAGTTC -3'
(R):5'- GGACGATAGTTCTAGCCCTAAGTC -3'
Posted On2014-05-23