Mutagenetix > Incidental Mutation

Incidental Mutation 'R1734:Pepd'

199568

Institutional Source

Beutler Lab

Gene Symbol

Pepd

Ensembl Gene

ENSMUSG00000063931

Gene Name

peptidase D

Synonyms

Pep4, Pep-4, dal, peptidase D

MMRRC Submission

039766-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1734 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

34912379-35044708 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 35031426 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 301 (D301V)

Ref Sequence

ENSEMBL: ENSMUSP00000075683 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075068]

AlphaFold

Q11136

Predicted Effect

probably benign
Transcript: ENSMUST00000075068
AA Change: D301V

PolyPhen 2 Score 0.068 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000075683
Gene: ENSMUSG00000063931
AA Change: D301V

Domain	Start	End	E-Value	Type
AMP_N	18	155	2.71e-39	SMART
Pfam:Peptidase_M24	193	459	5.4e-61	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000161128

Meta Mutation Damage Score

0.5206

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 92.9%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase family. The protein forms a homodimer that hydrolyzes dipeptides or tripeptides with C-terminal proline or hydroxyproline residues. The enzyme serves an important role in the recycling of proline, and may be rate limiting for the production of collagen. Mutations in this gene result in prolidase deficiency, which is characterized by the excretion of large amount of di- and tri-peptides containing proline. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants are smaller than normal siblings and, except on the flanks, an agouti coat appears nonagouti. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,585,460	C4695R	probably benign	Het
Actr10	T	A	12: 70,961,996	V401E	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Aimp1	A	T	3: 132,674,796	I59K	probably damaging	Het
Alms1	T	A	6: 85,641,550		probably null	Het
Anln	A	T	9: 22,350,955	S947T	possibly damaging	Het
Atp2c1	T	C	9: 105,414,655	T733A	probably damaging	Het
BC049715	C	T	6: 136,840,308	P182L	probably damaging	Het
Cblb	T	C	16: 52,186,240		probably benign	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Chac1	A	T	2: 119,353,458	L180F	probably damaging	Het
Cherp	A	T	8: 72,470,088		probably null	Het
Ckap4	A	G	10: 84,527,874	S442P	probably benign	Het
Clstn3	G	A	6: 124,436,814		probably benign	Het
Crb2	T	A	2: 37,793,656	C1057S	probably damaging	Het
Dact2	T	C	17: 14,196,639	D433G	probably benign	Het
Dnah6	G	A	6: 73,044,761	T3526M	probably damaging	Het
Ethe1	A	G	7: 24,608,384	T210A	probably benign	Het
Fat2	A	G	11: 55,281,371	S2839P	probably benign	Het
Fbxl7	T	C	15: 26,543,649	Y304C	probably damaging	Het
Gad1-ps	A	T	10: 99,445,775		noncoding transcript	Het
Gm436	A	T	4: 144,670,026	C379S	probably benign	Het
Grm3	C	T	5: 9,589,742	R101K	probably benign	Het
Hspa12b	A	G	2: 131,138,536	Y125C	possibly damaging	Het
Il10ra	T	C	9: 45,255,943	T437A	probably benign	Het
Jcad	T	C	18: 4,674,526	F763L	probably damaging	Het
Map3k10	T	C	7: 27,658,115	D746G	probably damaging	Het
Mettl9	T	A	7: 121,047,841	Y57N	probably damaging	Het
Nav2	G	A	7: 49,575,720	E1803K	probably damaging	Het
Nol11	G	A	11: 107,175,623	S447L	possibly damaging	Het
Olfr294	C	T	7: 86,616,217	V143M	probably benign	Het
Osbpl1a	T	C	18: 12,788,316		probably null	Het
Pde6a	A	G	18: 61,285,965	N804S	probably damaging	Het
Piwil2	A	T	14: 70,426,505		probably null	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Prrc2a	A	G	17: 35,150,707	S1877P	possibly damaging	Het
Retreg2	G	T	1: 75,142,986		probably null	Het
Slc7a11	G	A	3: 50,372,346	Q489*	probably null	Het
Sned1	G	A	1: 93,259,768	D256N	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Ssfa2	G	A	2: 79,657,822	V750M	probably damaging	Het
Syce2	G	A	8: 84,887,147	E168K	probably benign	Het
Tex37	T	A	6: 70,913,661	Q49L	probably benign	Het
Tmem260	G	T	14: 48,509,093	V609L	probably benign	Het
Trim35	A	G	14: 66,309,329	D515G	probably damaging	Het
Tspan5	T	C	3: 138,898,140	Y131H	probably damaging	Het
Ttbk2	T	C	2: 120,755,838	I466V	probably benign	Het
Ttn	T	C	2: 76,745,813	D24912G	probably damaging	Het
Utp20	A	T	10: 88,767,461	N1843K	probably damaging	Het
Vmn1r20	A	G	6: 57,432,300	R204G	probably damaging	Het
Vps18	A	T	2: 119,293,942	Q450L	probably benign	Het
Zbtb4	A	G	11: 69,776,463	E198G	probably benign	Het

Other mutations in Pepd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01522:Pepd	APN	7	34924440	missense	probably benign
IGL02102:Pepd	APN	7	34945603	missense	probably damaging	1.00
R1256:Pepd	UTSW	7	34921492	missense	possibly damaging	0.95
R1690:Pepd	UTSW	7	35031357	missense	probably damaging	1.00
R1911:Pepd	UTSW	7	34934749	splice site	probably benign
R1918:Pepd	UTSW	7	34971676	missense	probably benign	0.00
R2144:Pepd	UTSW	7	34921418	missense	probably benign	0.09
R4814:Pepd	UTSW	7	34945597	missense	probably damaging	0.96
R4924:Pepd	UTSW	7	35020984	missense	probably benign	0.24
R5490:Pepd	UTSW	7	34942690	splice site	probably null
R5669:Pepd	UTSW	7	35040674	missense	probably benign	0.38
R6240:Pepd	UTSW	7	35021751	missense	probably benign	0.00
R6300:Pepd	UTSW	7	34969543	missense	probably damaging	1.00
R6479:Pepd	UTSW	7	35040722	missense	probably benign	0.00
R6995:Pepd	UTSW	7	35021719	missense	probably damaging	1.00
R7303:Pepd	UTSW	7	35021772	critical splice donor site	probably null
R7587:Pepd	UTSW	7	34969540	missense	probably damaging	1.00
R8008:Pepd	UTSW	7	35021701	missense	probably benign	0.22
R8672:Pepd	UTSW	7	34942682	missense	probably damaging	0.97
R8815:Pepd	UTSW	7	34971691	missense	probably damaging	1.00
R9037:Pepd	UTSW	7	35020973	missense	probably benign
R9489:Pepd	UTSW	7	35043793	missense	probably benign	0.10
R9605:Pepd	UTSW	7	35043793	missense	probably benign	0.10
R9646:Pepd	UTSW	7	34921457	missense	possibly damaging	0.47
X0021:Pepd	UTSW	7	34954563	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCAAGGCCAGGCTTCTTCCTTAG -3'
(R):5'- CCTGCGGTGTCTGTCAGTCAAG -3'

Sequencing Primer
(F):5'- tgagattgtgggggaggg -3'
(R):5'- CAGTCAAGATGTATGTTCAGTCCC -3'

Posted On

2014-05-23