Mutagenetix > Incidental Mutations

Incidental Mutation 'R1734:Nav2'

199569

Institutional Source

Beutler Lab

Gene Symbol

Nav2

Ensembl Gene

ENSMUSG00000052512

Gene Name

neuron navigator 2

Synonyms

Rainb1, HELAD1, Unc53H2, RAINB2, 5330421F07Rik, POMFIL2

MMRRC Submission

039766-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.636) question?

Stock #

R1734 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

48908716-49610090 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 49575720 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1803 (E1803K)

Ref Sequence

ENSEMBL: ENSMUSP00000139045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000064395] [ENSMUST00000183659] [ENSMUST00000184945]

Predicted Effect

probably damaging
Transcript: ENSMUST00000064395
AA Change: E1803K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000067448
Gene: ENSMUSG00000052512
AA Change: E1803K

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000183659
AA Change: E1742K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139309
Gene: ENSMUSG00000052512
AA Change: E1742K

Domain	Start	End	E-Value	Type
low complexity region	2	11	N/A	INTRINSIC
CH	23	126	6.19e-16	SMART
low complexity region	141	149	N/A	INTRINSIC
low complexity region	236	249	N/A	INTRINSIC
low complexity region	276	287	N/A	INTRINSIC
low complexity region	351	363	N/A	INTRINSIC
coiled coil region	425	455	N/A	INTRINSIC
low complexity region	519	530	N/A	INTRINSIC
low complexity region	552	564	N/A	INTRINSIC
low complexity region	579	601	N/A	INTRINSIC
low complexity region	785	796	N/A	INTRINSIC
low complexity region	859	883	N/A	INTRINSIC
low complexity region	886	906	N/A	INTRINSIC
low complexity region	929	943	N/A	INTRINSIC
low complexity region	1001	1013	N/A	INTRINSIC
low complexity region	1282	1299	N/A	INTRINSIC
low complexity region	1307	1324	N/A	INTRINSIC
low complexity region	1356	1371	N/A	INTRINSIC
low complexity region	1393	1405	N/A	INTRINSIC
low complexity region	1465	1479	N/A	INTRINSIC
low complexity region	1553	1567	N/A	INTRINSIC
coiled coil region	1569	1656	N/A	INTRINSIC
low complexity region	1728	1739	N/A	INTRINSIC
coiled coil region	1780	1848	N/A	INTRINSIC
AAA	2032	2186	1.69e-5	SMART
low complexity region	2343	2369	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184102

Predicted Effect

probably damaging
Transcript: ENSMUST00000184945
AA Change: E1803K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000139045
Gene: ENSMUSG00000052512
AA Change: E1803K

Domain	Start	End	E-Value	Type
CH	84	187	1.58e-13	SMART
low complexity region	202	210	N/A	INTRINSIC
low complexity region	297	310	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
low complexity region	412	424	N/A	INTRINSIC
coiled coil region	486	516	N/A	INTRINSIC
low complexity region	580	591	N/A	INTRINSIC
low complexity region	613	625	N/A	INTRINSIC
low complexity region	640	662	N/A	INTRINSIC
low complexity region	846	857	N/A	INTRINSIC
low complexity region	920	944	N/A	INTRINSIC
low complexity region	947	967	N/A	INTRINSIC
low complexity region	990	1004	N/A	INTRINSIC
low complexity region	1062	1074	N/A	INTRINSIC
low complexity region	1343	1360	N/A	INTRINSIC
low complexity region	1368	1385	N/A	INTRINSIC
low complexity region	1417	1432	N/A	INTRINSIC
low complexity region	1454	1466	N/A	INTRINSIC
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1614	1628	N/A	INTRINSIC
coiled coil region	1630	1717	N/A	INTRINSIC
low complexity region	1789	1800	N/A	INTRINSIC
coiled coil region	1841	1909	N/A	INTRINSIC
AAA	2093	2247	1.69e-5	SMART
low complexity region	2404	2430	N/A	INTRINSIC

Meta Mutation Damage Score

0.1244

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 92.9%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neuron navigator gene family, which may play a role in cellular growth and migration. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygous null mice display impaired olfaction and hearing, increased latency in a hot plate test, degeneration of the optic nerve, decreased exploration in new environments, and weight loss. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,585,460	C4695R	probably benign	Het
Actr10	T	A	12: 70,961,996	V401E	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Aimp1	A	T	3: 132,674,796	I59K	probably damaging	Het
Alms1	T	A	6: 85,641,550		probably null	Het
Anln	A	T	9: 22,350,955	S947T	possibly damaging	Het
Atp2c1	T	C	9: 105,414,655	T733A	probably damaging	Het
BC049715	C	T	6: 136,840,308	P182L	probably damaging	Het
Cblb	T	C	16: 52,186,240		probably benign	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Chac1	A	T	2: 119,353,458	L180F	probably damaging	Het
Cherp	A	T	8: 72,470,088		probably null	Het
Ckap4	A	G	10: 84,527,874	S442P	probably benign	Het
Clstn3	G	A	6: 124,436,814		probably benign	Het
Crb2	T	A	2: 37,793,656	C1057S	probably damaging	Het
Dact2	T	C	17: 14,196,639	D433G	probably benign	Het
Dnah6	G	A	6: 73,044,761	T3526M	probably damaging	Het
Ethe1	A	G	7: 24,608,384	T210A	probably benign	Het
Fat2	A	G	11: 55,281,371	S2839P	probably benign	Het
Fbxl7	T	C	15: 26,543,649	Y304C	probably damaging	Het
Gad1-ps	A	T	10: 99,445,775		noncoding transcript	Het
Gm436	A	T	4: 144,670,026	C379S	probably benign	Het
Grm3	C	T	5: 9,589,742	R101K	probably benign	Het
Hspa12b	A	G	2: 131,138,536	Y125C	possibly damaging	Het
Il10ra	T	C	9: 45,255,943	T437A	probably benign	Het
Jcad	T	C	18: 4,674,526	F763L	probably damaging	Het
Map3k10	T	C	7: 27,658,115	D746G	probably damaging	Het
Mettl9	T	A	7: 121,047,841	Y57N	probably damaging	Het
Nol11	G	A	11: 107,175,623	S447L	possibly damaging	Het
Olfr294	C	T	7: 86,616,217	V143M	probably benign	Het
Osbpl1a	T	C	18: 12,788,316		probably null	Het
Pde6a	A	G	18: 61,285,965	N804S	probably damaging	Het
Pepd	A	T	7: 35,031,426	D301V	probably benign	Het
Piwil2	A	T	14: 70,426,505		probably null	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Prrc2a	A	G	17: 35,150,707	S1877P	possibly damaging	Het
Retreg2	G	T	1: 75,142,986		probably null	Het
Slc7a11	G	A	3: 50,372,346	Q489*	probably null	Het
Sned1	G	A	1: 93,259,768	D256N	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Ssfa2	G	A	2: 79,657,822	V750M	probably damaging	Het
Syce2	G	A	8: 84,887,147	E168K	probably benign	Het
Tex37	T	A	6: 70,913,661	Q49L	probably benign	Het
Tmem260	G	T	14: 48,509,093	V609L	probably benign	Het
Trim35	A	G	14: 66,309,329	D515G	probably damaging	Het
Tspan5	T	C	3: 138,898,140	Y131H	probably damaging	Het
Ttbk2	T	C	2: 120,755,838	I466V	probably benign	Het
Ttn	T	C	2: 76,745,813	D24912G	probably damaging	Het
Utp20	A	T	10: 88,767,461	N1843K	probably damaging	Het
Vmn1r20	A	G	6: 57,432,300	R204G	probably damaging	Het
Vps18	A	T	2: 119,293,942	Q450L	probably benign	Het
Zbtb4	A	G	11: 69,776,463	E198G	probably benign	Het

Other mutations in Nav2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01097:Nav2	APN	7	49571194	missense	probably damaging	1.00
IGL01150:Nav2	APN	7	49452521	missense	probably benign	0.17
IGL01649:Nav2	APN	7	49575729	missense	probably damaging	1.00
IGL01662:Nav2	APN	7	49571209	missense	probably damaging	1.00
IGL02297:Nav2	APN	7	49594229	missense	probably damaging	0.98
IGL02313:Nav2	APN	7	49558773	missense	probably damaging	0.99
IGL02441:Nav2	APN	7	49452512	missense	probably damaging	1.00
IGL02472:Nav2	APN	7	49546041	missense	probably damaging	1.00
IGL02477:Nav2	APN	7	49582875	missense	probably damaging	0.99
IGL02725:Nav2	APN	7	49565095	missense	probably damaging	1.00
IGL02944:Nav2	APN	7	49420256	missense	probably damaging	0.99
IGL02953:Nav2	APN	7	49548423	missense	probably damaging	1.00
IGL03105:Nav2	APN	7	49464879	missense	probably damaging	1.00
IGL03234:Nav2	APN	7	49462008	missense	possibly damaging	0.94
IGL03274:Nav2	APN	7	49362099	missense	probably damaging	1.00
IGL03294:Nav2	APN	7	49491457	nonsense	probably null
R0006:Nav2	UTSW	7	49453230	missense	possibly damaging	0.50
R0070:Nav2	UTSW	7	49570714	missense	probably damaging	1.00
R0113:Nav2	UTSW	7	49535953	missense	probably damaging	1.00
R0306:Nav2	UTSW	7	49545903	missense	probably benign	0.01
R0346:Nav2	UTSW	7	49604585	missense	probably benign	0.11
R0539:Nav2	UTSW	7	49461938	missense	probably damaging	1.00
R0669:Nav2	UTSW	7	49408683	missense	probably damaging	1.00
R0785:Nav2	UTSW	7	49420333	missense	probably benign	0.06
R0970:Nav2	UTSW	7	49584153	missense	probably damaging	1.00
R1162:Nav2	UTSW	7	49536040	splice site	probably benign
R1274:Nav2	UTSW	7	49604430	nonsense	probably null
R1463:Nav2	UTSW	7	49535962	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1464:Nav2	UTSW	7	49362204	missense	probably damaging	1.00
R1536:Nav2	UTSW	7	49545934	missense	probably damaging	1.00
R1612:Nav2	UTSW	7	49571211	missense	probably damaging	1.00
R1638:Nav2	UTSW	7	49452465	missense	probably benign
R1731:Nav2	UTSW	7	49548174	missense	probably damaging	1.00
R1865:Nav2	UTSW	7	49548195	missense	possibly damaging	0.95
R1945:Nav2	UTSW	7	49464872	missense	probably damaging	1.00
R1997:Nav2	UTSW	7	49548471	missense	probably benign	0.16
R2061:Nav2	UTSW	7	49598897	splice site	probably benign
R2117:Nav2	UTSW	7	49464580	missense	probably benign	0.00
R2174:Nav2	UTSW	7	49452663	missense	probably damaging	0.99
R2182:Nav2	UTSW	7	49597254	missense	probably benign	0.38
R2251:Nav2	UTSW	7	49453277	missense	probably damaging	1.00
R2283:Nav2	UTSW	7	49491404	missense	probably damaging	1.00
R2343:Nav2	UTSW	7	49598817	missense	possibly damaging	0.82
R2472:Nav2	UTSW	7	49408884	missense	probably benign
R2568:Nav2	UTSW	7	49597564	missense	probably damaging	1.00
R2656:Nav2	UTSW	7	49545942	missense	probably damaging	1.00
R2964:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R2966:Nav2	UTSW	7	49557032	missense	probably damaging	1.00
R3817:Nav2	UTSW	7	49464562	missense	probably benign	0.00
R3834:Nav2	UTSW	7	49545858	missense	possibly damaging	0.91
R4207:Nav2	UTSW	7	49572298	splice site	probably null
R4207:Nav2	UTSW	7	49597231	missense	probably damaging	1.00
R4411:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4413:Nav2	UTSW	7	49398109	missense	probably benign	0.37
R4440:Nav2	UTSW	7	49552037	missense	possibly damaging	0.86
R4440:Nav2	UTSW	7	49575263	splice site	probably benign
R4454:Nav2	UTSW	7	49548544	splice site	probably null
R4729:Nav2	UTSW	7	49452819	missense	probably benign	0.17
R4801:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4802:Nav2	UTSW	7	49545852	missense	possibly damaging	0.94
R4824:Nav2	UTSW	7	49409001	intron	probably benign
R4887:Nav2	UTSW	7	49548434	nonsense	probably null
R4908:Nav2	UTSW	7	49604510	missense	probably damaging	1.00
R4952:Nav2	UTSW	7	49304540	intron	probably benign
R4965:Nav2	UTSW	7	49552877	nonsense	probably null
R5169:Nav2	UTSW	7	49548483	nonsense	probably null
R5224:Nav2	UTSW	7	49551725	missense	probably benign	0.00
R5249:Nav2	UTSW	7	49535913	missense	probably damaging	1.00
R5285:Nav2	UTSW	7	49548234	missense	probably damaging	1.00
R5314:Nav2	UTSW	7	49408692	small deletion	probably benign
R5320:Nav2	UTSW	7	49491373	missense	probably benign	0.00
R5377:Nav2	UTSW	7	49589160	missense	probably benign	0.02
R5471:Nav2	UTSW	7	49548169	missense	probably damaging	1.00
R5754:Nav2	UTSW	7	49557046	missense	probably damaging	1.00
R5832:Nav2	UTSW	7	49548069	splice site	probably null
R5884:Nav2	UTSW	7	49597169	nonsense	probably null
R5921:Nav2	UTSW	7	49304576	intron	probably benign
R6180:Nav2	UTSW	7	49458167	missense	probably benign	0.39
R6208:Nav2	UTSW	7	49564103	missense	probably damaging	0.99
R6373:Nav2	UTSW	7	49453175	missense	probably damaging	1.00
R6450:Nav2	UTSW	7	49594366	missense	probably damaging	1.00
R6522:Nav2	UTSW	7	49597533	missense	probably damaging	1.00
R6626:Nav2	UTSW	7	49594352	missense	probably damaging	1.00
R6695:Nav2	UTSW	7	49464904	missense	probably benign	0.04
R6705:Nav2	UTSW	7	49551916	missense	probably damaging	1.00
R6842:Nav2	UTSW	7	49458169	missense	possibly damaging	0.91
R6847:Nav2	UTSW	7	49491456	missense	probably benign	0.14
R7287:Nav2	UTSW	7	49420328	missense	probably benign	0.01
R7312:Nav2	UTSW	7	49461924	missense	possibly damaging	0.55
R7315:Nav2	UTSW	7	49548289	missense	possibly damaging	0.61
R7337:Nav2	UTSW	7	49551773	missense	possibly damaging	0.56
R7366:Nav2	UTSW	7	49554203	splice site	probably null
R7451:Nav2	UTSW	7	49552829	splice site	probably null
R7545:Nav2	UTSW	7	49582857	missense	probably damaging	1.00
R7706:Nav2	UTSW	7	49594319	missense	probably benign	0.35
R7730:Nav2	UTSW	7	49572397	missense	probably damaging	1.00
R7812:Nav2	UTSW	7	49597173	missense	probably benign	0.13
R8097:Nav2	UTSW	7	49587777	missense	probably damaging	1.00
R8110:Nav2	UTSW	7	49551950	nonsense	probably null
R8119:Nav2	UTSW	7	49453484	missense	probably damaging	0.99
R8298:Nav2	UTSW	7	49554261	critical splice donor site	probably null
R8306:Nav2	UTSW	7	49546017	missense	probably benign	0.33
R8331:Nav2	UTSW	7	49452623	missense	probably benign
R8402:Nav2	UTSW	7	49453437	missense	probably benign	0.43
R8421:Nav2	UTSW	7	49452521	missense	probably benign
R8478:Nav2	UTSW	7	49461985	missense	probably damaging	0.99
R8724:Nav2	UTSW	7	49491436	missense	possibly damaging	0.82
R8753:Nav2	UTSW	7	49452572	missense	probably benign
X0023:Nav2	UTSW	7	49547899	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49452761	missense	possibly damaging	0.47
Z1177:Nav2	UTSW	7	49594223	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TGCACTGATCCCACAGAGCTGTTG -3'
(R):5'- TAAGTGCCACCTGTCCTGAACTCC -3'

Sequencing Primer
(F):5'- CACAGAGCTGTTGTGTGCC -3'
(R):5'- AGaaacaaacaaacaaacaaacaaac -3'

Posted On

2014-05-23