Incidental Mutation 'R1734:Syce2'
ID199574
Institutional Source Beutler Lab
Gene Symbol Syce2
Ensembl Gene ENSMUSG00000003824
Gene Namesynaptonemal complex central element protein 2
Synonyms
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84872111-84888221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84887147 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 168 (E168K)
Ref Sequence ENSEMBL: ENSMUSP00000131438 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003907] [ENSMUST00000003922] [ENSMUST00000109745] [ENSMUST00000136026] [ENSMUST00000170296]
Predicted Effect probably benign
Transcript: ENSMUST00000003907
SMART Domains Protein: ENSMUSP00000003907
Gene: ENSMUSG00000003809

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 61 172 1.5e-29 PFAM
Pfam:Acyl-CoA_dh_M 176 269 3.8e-22 PFAM
Pfam:Acyl-CoA_dh_1 287 429 2.9e-30 PFAM
Pfam:Acyl-CoA_dh_2 295 418 3.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000003922
Predicted Effect probably benign
Transcript: ENSMUST00000109745
SMART Domains Protein: ENSMUSP00000105367
Gene: ENSMUSG00000003809

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
Pfam:Acyl-CoA_dh_N 61 172 8.2e-28 PFAM
Pfam:Acyl-CoA_dh_M 176 230 2.2e-21 PFAM
low complexity region 269 280 N/A INTRINSIC
Pfam:Acyl-CoA_dh_1 287 429 2.6e-30 PFAM
Pfam:Acyl-CoA_dh_2 295 418 2.1e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136026
AA Change: E162K

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000122159
Gene: ENSMUSG00000003824
AA Change: E162K

DomainStartEndE-ValueType
coiled coil region 52 83 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136462
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144466
Predicted Effect probably benign
Transcript: ENSMUST00000170296
AA Change: E168K

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000131438
Gene: ENSMUSG00000003824
AA Change: E168K

DomainStartEndE-ValueType
coiled coil region 58 89 N/A INTRINSIC
Meta Mutation Damage Score 0.0934 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the synaptonemal complex formed between homologous chromosomes during meiotic prophase. The encoded protein associates with SYCP1 and SYCE1 and is found only where chromosome cores are synapsed. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homogyzous for a null mutation are infertile with decreases in testis and ovary weights, arrest of spermatogenesis, and abnormal meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Syce2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5532:Syce2 UTSW 8 84883502 missense probably damaging 1.00
R6306:Syce2 UTSW 8 84872742 missense possibly damaging 0.92
R8506:Syce2 UTSW 8 84887166 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCACTTGCCAACCGTGAATGCC -3'
(R):5'- TGCCCCAATGACAGGATTTGAACC -3'

Sequencing Primer
(F):5'- CGTGAATGCCTGAATCCCAG -3'
(R):5'- AAGGACCAGCCATGTTTTTGC -3'
Posted On2014-05-23