Incidental Mutation 'R1734:Ces4a'
ID199575
Institutional Source Beutler Lab
Gene Symbol Ces4a
Ensembl Gene ENSMUSG00000060560
Gene Namecarboxylesterase 4A
SynonymsCes8
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105131800-105150109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105138097 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 69 (G69S)
Ref Sequence ENSEMBL: ENSMUSP00000125062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161289]
Predicted Effect probably damaging
Transcript: ENSMUST00000161289
AA Change: G69S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125062
Gene: ENSMUSG00000060560
AA Change: G69S

DomainStartEndE-ValueType
Pfam:COesterase 8 554 4.9e-163 PFAM
Pfam:Abhydrolase_3 143 319 2e-9 PFAM
Meta Mutation Damage Score 0.7473 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES6, encodes a secreted enzyme, and may play a role in the detoxification of drugs and xenobiotics in neural and other tissues of the body and in the cerebrospinal fluid. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Ces4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Ces4a APN 8 105145163 missense probably benign 0.00
IGL01574:Ces4a APN 8 105145227 splice site probably benign
IGL01655:Ces4a APN 8 105147174 missense probably damaging 0.99
IGL03092:Ces4a APN 8 105148204 splice site probably benign
IGL03151:Ces4a APN 8 105148197 critical splice donor site probably null
F6893:Ces4a UTSW 8 105147227 missense possibly damaging 0.74
R0266:Ces4a UTSW 8 105141966 missense probably benign
R0659:Ces4a UTSW 8 105144922 splice site probably benign
R1239:Ces4a UTSW 8 105149498 missense probably damaging 1.00
R1467:Ces4a UTSW 8 105138035 missense possibly damaging 0.56
R1467:Ces4a UTSW 8 105138035 missense possibly damaging 0.56
R1505:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1509:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1598:Ces4a UTSW 8 105142821 missense probably damaging 1.00
R1736:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1737:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1738:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1744:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1789:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1951:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1953:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2126:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2129:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2202:Ces4a UTSW 8 105146114 missense probably damaging 1.00
R4512:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R4865:Ces4a UTSW 8 105147158 missense probably benign 0.05
R4934:Ces4a UTSW 8 105137981 missense probably benign 0.30
R4936:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R5255:Ces4a UTSW 8 105142489 missense probably benign 0.00
R5342:Ces4a UTSW 8 105146143 missense probably benign 0.07
R5647:Ces4a UTSW 8 105146080 missense probably benign 0.10
R6062:Ces4a UTSW 8 105138174 critical splice donor site probably null
R6490:Ces4a UTSW 8 105149458 missense probably benign 0.09
R6606:Ces4a UTSW 8 105149378 missense possibly damaging 0.95
R6876:Ces4a UTSW 8 105144992 missense possibly damaging 0.56
R6901:Ces4a UTSW 8 105146698 missense probably benign
R7519:Ces4a UTSW 8 105145219 missense probably damaging 1.00
R7682:Ces4a UTSW 8 105146665 missense probably benign 0.00
R8171:Ces4a UTSW 8 105147207 missense probably damaging 1.00
R8329:Ces4a UTSW 8 105148082 missense probably damaging 1.00
Z1176:Ces4a UTSW 8 105131977 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCAGATGTACCAGAATCCCATCC -3'
(R):5'- AACCGAAGCCAAGAATAGGTTCCAG -3'

Sequencing Primer
(F):5'- CATGGTTGAGAAGCATAAGAAGAC -3'
(R):5'- CCAAGAATAGGTTCCAGGTTTGC -3'
Posted On2014-05-23