Mutagenetix > Incidental Mutation

Incidental Mutation 'R1734:Ces4a'

199575

Institutional Source

Beutler Lab

Gene Symbol

Ces4a

Ensembl Gene

ENSMUSG00000060560

Gene Name

carboxylesterase 4A

Synonyms

Ces8

MMRRC Submission

039766-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1734 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105131800-105150109 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 105138097 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Serine at position 69 (G69S)

Ref Sequence

ENSEMBL: ENSMUSP00000125062 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000161289]

AlphaFold

Q8R0W5

Predicted Effect

probably damaging
Transcript: ENSMUST00000161289
AA Change: G69S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125062
Gene: ENSMUSG00000060560
AA Change: G69S

Domain	Start	End	E-Value	Type
Pfam:COesterase	8	554	4.9e-163	PFAM
Pfam:Abhydrolase_3	143	319	2e-9	PFAM

Meta Mutation Damage Score

0.7473

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 92.9%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES6, encodes a secreted enzyme, and may play a role in the detoxification of drugs and xenobiotics in neural and other tissues of the body and in the cerebrospinal fluid. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2010]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,585,460	C4695R	probably benign	Het
Actr10	T	A	12: 70,961,996	V401E	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Aimp1	A	T	3: 132,674,796	I59K	probably damaging	Het
Alms1	T	A	6: 85,641,550		probably null	Het
Anln	A	T	9: 22,350,955	S947T	possibly damaging	Het
Atp2c1	T	C	9: 105,414,655	T733A	probably damaging	Het
BC049715	C	T	6: 136,840,308	P182L	probably damaging	Het
Cblb	T	C	16: 52,186,240		probably benign	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Chac1	A	T	2: 119,353,458	L180F	probably damaging	Het
Cherp	A	T	8: 72,470,088		probably null	Het
Ckap4	A	G	10: 84,527,874	S442P	probably benign	Het
Clstn3	G	A	6: 124,436,814		probably benign	Het
Crb2	T	A	2: 37,793,656	C1057S	probably damaging	Het
Dact2	T	C	17: 14,196,639	D433G	probably benign	Het
Dnah6	G	A	6: 73,044,761	T3526M	probably damaging	Het
Ethe1	A	G	7: 24,608,384	T210A	probably benign	Het
Fat2	A	G	11: 55,281,371	S2839P	probably benign	Het
Fbxl7	T	C	15: 26,543,649	Y304C	probably damaging	Het
Gad1-ps	A	T	10: 99,445,775		noncoding transcript	Het
Gm436	A	T	4: 144,670,026	C379S	probably benign	Het
Grm3	C	T	5: 9,589,742	R101K	probably benign	Het
Hspa12b	A	G	2: 131,138,536	Y125C	possibly damaging	Het
Il10ra	T	C	9: 45,255,943	T437A	probably benign	Het
Jcad	T	C	18: 4,674,526	F763L	probably damaging	Het
Map3k10	T	C	7: 27,658,115	D746G	probably damaging	Het
Mettl9	T	A	7: 121,047,841	Y57N	probably damaging	Het
Nav2	G	A	7: 49,575,720	E1803K	probably damaging	Het
Nol11	G	A	11: 107,175,623	S447L	possibly damaging	Het
Olfr294	C	T	7: 86,616,217	V143M	probably benign	Het
Osbpl1a	T	C	18: 12,788,316		probably null	Het
Pde6a	A	G	18: 61,285,965	N804S	probably damaging	Het
Pepd	A	T	7: 35,031,426	D301V	probably benign	Het
Piwil2	A	T	14: 70,426,505		probably null	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Prrc2a	A	G	17: 35,150,707	S1877P	possibly damaging	Het
Retreg2	G	T	1: 75,142,986		probably null	Het
Slc7a11	G	A	3: 50,372,346	Q489*	probably null	Het
Sned1	G	A	1: 93,259,768	D256N	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Ssfa2	G	A	2: 79,657,822	V750M	probably damaging	Het
Syce2	G	A	8: 84,887,147	E168K	probably benign	Het
Tex37	T	A	6: 70,913,661	Q49L	probably benign	Het
Tmem260	G	T	14: 48,509,093	V609L	probably benign	Het
Trim35	A	G	14: 66,309,329	D515G	probably damaging	Het
Tspan5	T	C	3: 138,898,140	Y131H	probably damaging	Het
Ttbk2	T	C	2: 120,755,838	I466V	probably benign	Het
Ttn	T	C	2: 76,745,813	D24912G	probably damaging	Het
Utp20	A	T	10: 88,767,461	N1843K	probably damaging	Het
Vmn1r20	A	G	6: 57,432,300	R204G	probably damaging	Het
Vps18	A	T	2: 119,293,942	Q450L	probably benign	Het
Zbtb4	A	G	11: 69,776,463	E198G	probably benign	Het

Other mutations in Ces4a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00584:Ces4a	APN	8	105145163	missense	probably benign	0.00
IGL01574:Ces4a	APN	8	105145227	splice site	probably benign
IGL01655:Ces4a	APN	8	105147174	missense	probably damaging	0.99
IGL03092:Ces4a	APN	8	105148204	splice site	probably benign
IGL03151:Ces4a	APN	8	105148197	critical splice donor site	probably null
F6893:Ces4a	UTSW	8	105147227	missense	possibly damaging	0.74
R0266:Ces4a	UTSW	8	105141966	missense	probably benign
R0659:Ces4a	UTSW	8	105144922	splice site	probably benign
R1239:Ces4a	UTSW	8	105149498	missense	probably damaging	1.00
R1467:Ces4a	UTSW	8	105138035	missense	possibly damaging	0.56
R1467:Ces4a	UTSW	8	105138035	missense	possibly damaging	0.56
R1505:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1509:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1598:Ces4a	UTSW	8	105142821	missense	probably damaging	1.00
R1736:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1737:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1738:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1744:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1789:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1951:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R1953:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R2126:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R2129:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R2202:Ces4a	UTSW	8	105146114	missense	probably damaging	1.00
R4512:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R4865:Ces4a	UTSW	8	105147158	missense	probably benign	0.05
R4934:Ces4a	UTSW	8	105137981	missense	probably benign	0.30
R4936:Ces4a	UTSW	8	105138097	missense	probably damaging	1.00
R5255:Ces4a	UTSW	8	105142489	missense	probably benign	0.00
R5342:Ces4a	UTSW	8	105146143	missense	probably benign	0.07
R5647:Ces4a	UTSW	8	105146080	missense	probably benign	0.10
R6062:Ces4a	UTSW	8	105138174	critical splice donor site	probably null
R6490:Ces4a	UTSW	8	105149458	missense	probably benign	0.09
R6606:Ces4a	UTSW	8	105149378	missense	possibly damaging	0.95
R6876:Ces4a	UTSW	8	105144992	missense	possibly damaging	0.56
R6901:Ces4a	UTSW	8	105146698	missense	probably benign
R7519:Ces4a	UTSW	8	105145219	missense	probably damaging	1.00
R7682:Ces4a	UTSW	8	105146665	missense	probably benign	0.00
R8171:Ces4a	UTSW	8	105147207	missense	probably damaging	1.00
R8329:Ces4a	UTSW	8	105148082	missense	probably damaging	1.00
R8833:Ces4a	UTSW	8	105131982	missense	probably benign	0.00
R9168:Ces4a	UTSW	8	105149418	missense	probably benign	0.00
R9557:Ces4a	UTSW	8	105142895	missense	possibly damaging	0.92
R9758:Ces4a	UTSW	8	105142422	missense	possibly damaging	0.50
Z1176:Ces4a	UTSW	8	105131977	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGGCAGATGTACCAGAATCCCATCC -3'
(R):5'- AACCGAAGCCAAGAATAGGTTCCAG -3'

Sequencing Primer
(F):5'- CATGGTTGAGAAGCATAAGAAGAC -3'
(R):5'- CCAAGAATAGGTTCCAGGTTTGC -3'

Posted On

2014-05-23