Incidental Mutation 'R1734:Il10ra'
ID199579
Institutional Source Beutler Lab
Gene Symbol Il10ra
Ensembl Gene ENSMUSG00000032089
Gene Nameinterleukin 10 receptor, alpha
SynonymsCDw210, Il10r, mIL-10R
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location45253837-45269149 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45255943 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 437 (T437A)
Ref Sequence ENSEMBL: ENSMUSP00000135461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034594] [ENSMUST00000176222] [ENSMUST00000176808]
Predicted Effect probably benign
Transcript: ENSMUST00000034594
AA Change: T439A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034594
Gene: ENSMUSG00000032089
AA Change: T439A

DomainStartEndE-ValueType
Pfam:Tissue_fac 5 114 3.3e-29 PFAM
SCOP:d1lqsr2 125 231 5e-59 SMART
transmembrane domain 239 261 N/A INTRINSIC
low complexity region 482 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176222
AA Change: T437A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135461
Gene: ENSMUSG00000032089
AA Change: T437A

DomainStartEndE-ValueType
Pfam:Tissue_fac 2 112 3.5e-26 PFAM
SCOP:d1lqsr2 123 229 5e-59 SMART
transmembrane domain 237 259 N/A INTRINSIC
low complexity region 480 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176808
SMART Domains Protein: ENSMUSP00000135361
Gene: ENSMUSG00000032089

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for interleukin 10. This protein is structurally related to interferon receptors. It has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. This receptor is reported to promote survival of progenitor myeloid cells through the insulin receptor substrate-2/PI 3-kinase/AKT pathway. Activation of this receptor leads to tyrosine phosphorylation of JAK1 and TYK2 kinases. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for an ENU-generated null allele suffer from a severe inflammatory bowel syndrome. Mice heterozygote for an NZW variant allele have high sera levels of anti-chromatin antibodies. Mice homozygous for a knock-out allele exhibit increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Il10ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Il10ra APN 9 45267160 missense probably damaging 1.00
IGL01916:Il10ra APN 9 45256146 missense probably damaging 1.00
IGL03067:Il10ra APN 9 45255859 missense probably benign 0.01
R0081:Il10ra UTSW 9 45255949 missense probably benign 0.04
R0266:Il10ra UTSW 9 45265652 missense probably benign 0.11
R1901:Il10ra UTSW 9 45256356 missense probably benign 0.39
R1991:Il10ra UTSW 9 45255811 missense probably benign 0.28
R2103:Il10ra UTSW 9 45255811 missense probably benign 0.28
R2218:Il10ra UTSW 9 45265616 missense probably benign
R4686:Il10ra UTSW 9 45269059 missense probably damaging 1.00
R4908:Il10ra UTSW 9 45255621 missense probably benign 0.21
R4982:Il10ra UTSW 9 45269059 missense probably damaging 1.00
R5590:Il10ra UTSW 9 45265626 nonsense probably null
R5739:Il10ra UTSW 9 45256070 missense possibly damaging 0.65
R5872:Il10ra UTSW 9 45255653 missense possibly damaging 0.92
R6053:Il10ra UTSW 9 45256303 missense probably damaging 0.99
R6282:Il10ra UTSW 9 45260405 missense probably damaging 0.98
R6798:Il10ra UTSW 9 45256432 missense probably damaging 0.99
R7060:Il10ra UTSW 9 45256224 missense probably benign 0.00
R7561:Il10ra UTSW 9 45255819 missense probably benign 0.00
R7630:Il10ra UTSW 9 45256071 missense probably damaging 1.00
R7709:Il10ra UTSW 9 45260399 missense probably benign 0.01
Z1176:Il10ra UTSW 9 45266632 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGGGCAAACCTCCAACTTTCTATGC -3'
(R):5'- ATACCCATCAGGACCAGGATGACAG -3'

Sequencing Primer
(F):5'- AGTGACCACTCTTCGGTCAG -3'
(R):5'- GACCAGGATGACAGTGACG -3'
Posted On2014-05-23