Incidental Mutation 'R1734:Il10ra'
ID 199579
Institutional Source Beutler Lab
Gene Symbol Il10ra
Ensembl Gene ENSMUSG00000032089
Gene Name interleukin 10 receptor, alpha
Synonyms Il10r, mIL-10R, CDw210
MMRRC Submission 039766-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1734 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 45165135-45180447 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 45167241 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 437 (T437A)
Ref Sequence ENSEMBL: ENSMUSP00000135461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034594] [ENSMUST00000176222] [ENSMUST00000176808]
AlphaFold Q61727
Predicted Effect probably benign
Transcript: ENSMUST00000034594
AA Change: T439A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000034594
Gene: ENSMUSG00000032089
AA Change: T439A

DomainStartEndE-ValueType
Pfam:Tissue_fac 5 114 3.3e-29 PFAM
SCOP:d1lqsr2 125 231 5e-59 SMART
transmembrane domain 239 261 N/A INTRINSIC
low complexity region 482 491 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176222
AA Change: T437A

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000135461
Gene: ENSMUSG00000032089
AA Change: T437A

DomainStartEndE-ValueType
Pfam:Tissue_fac 2 112 3.5e-26 PFAM
SCOP:d1lqsr2 123 229 5e-59 SMART
transmembrane domain 237 259 N/A INTRINSIC
low complexity region 480 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176808
SMART Domains Protein: ENSMUSP00000135361
Gene: ENSMUSG00000032089

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a receptor for interleukin 10. This protein is structurally related to interferon receptors. It has been shown to mediate the immunosuppressive signal of interleukin 10, and thus inhibits the synthesis of proinflammatory cytokines. This receptor is reported to promote survival of progenitor myeloid cells through the insulin receptor substrate-2/PI 3-kinase/AKT pathway. Activation of this receptor leads to tyrosine phosphorylation of JAK1 and TYK2 kinases. Two transcript variants, one protein-coding and the other not protein-coding, have been found for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for an ENU-generated null allele suffer from a severe inflammatory bowel syndrome. Mice heterozygote for an NZW variant allele have high sera levels of anti-chromatin antibodies. Mice homozygous for a knock-out allele exhibit increased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aadacl4fm4 A T 4: 144,396,596 (GRCm39) C379S probably benign Het
Abca13 T C 11: 9,535,460 (GRCm39) C4695R probably benign Het
Actr10 T A 12: 71,008,770 (GRCm39) V401E probably benign Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Aimp1 A T 3: 132,380,557 (GRCm39) I59K probably damaging Het
Alms1 T A 6: 85,618,532 (GRCm39) probably null Het
Anln A T 9: 22,262,251 (GRCm39) S947T possibly damaging Het
Atp2c1 T C 9: 105,291,854 (GRCm39) T733A probably damaging Het
BC049715 C T 6: 136,817,306 (GRCm39) P182L probably damaging Het
Cblb T C 16: 52,006,603 (GRCm39) probably benign Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Chac1 A T 2: 119,183,939 (GRCm39) L180F probably damaging Het
Cherp A T 8: 73,223,932 (GRCm39) probably null Het
Ckap4 A G 10: 84,363,738 (GRCm39) S442P probably benign Het
Clstn3 G A 6: 124,413,773 (GRCm39) probably benign Het
Crb2 T A 2: 37,683,668 (GRCm39) C1057S probably damaging Het
Dact2 T C 17: 14,416,901 (GRCm39) D433G probably benign Het
Dnah6 G A 6: 73,021,744 (GRCm39) T3526M probably damaging Het
Ethe1 A G 7: 24,307,809 (GRCm39) T210A probably benign Het
Fat2 A G 11: 55,172,197 (GRCm39) S2839P probably benign Het
Fbxl7 T C 15: 26,543,735 (GRCm39) Y304C probably damaging Het
Gad1-ps A T 10: 99,281,637 (GRCm39) noncoding transcript Het
Grm3 C T 5: 9,639,742 (GRCm39) R101K probably benign Het
Hspa12b A G 2: 130,980,456 (GRCm39) Y125C possibly damaging Het
Itprid2 G A 2: 79,488,166 (GRCm39) V750M probably damaging Het
Jcad T C 18: 4,674,526 (GRCm39) F763L probably damaging Het
Map3k10 T C 7: 27,357,540 (GRCm39) D746G probably damaging Het
Mettl9 T A 7: 120,647,064 (GRCm39) Y57N probably damaging Het
Nav2 G A 7: 49,225,468 (GRCm39) E1803K probably damaging Het
Nol11 G A 11: 107,066,449 (GRCm39) S447L possibly damaging Het
Or14a256 C T 7: 86,265,425 (GRCm39) V143M probably benign Het
Osbpl1a T C 18: 12,921,373 (GRCm39) probably null Het
Pde6a A G 18: 61,419,036 (GRCm39) N804S probably damaging Het
Pepd A T 7: 34,730,851 (GRCm39) D301V probably benign Het
Piwil2 A T 14: 70,663,954 (GRCm39) probably null Het
Plec C T 15: 76,070,418 (GRCm39) V931M probably damaging Het
Prrc2a A G 17: 35,369,683 (GRCm39) S1877P possibly damaging Het
Retreg2 G T 1: 75,119,630 (GRCm39) probably null Het
Slc7a11 G A 3: 50,326,795 (GRCm39) Q489* probably null Het
Sned1 G A 1: 93,187,490 (GRCm39) D256N probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Spmip9 T A 6: 70,890,645 (GRCm39) Q49L probably benign Het
Syce2 G A 8: 85,613,776 (GRCm39) E168K probably benign Het
Tmem260 G T 14: 48,746,550 (GRCm39) V609L probably benign Het
Trim35 A G 14: 66,546,778 (GRCm39) D515G probably damaging Het
Tspan5 T C 3: 138,603,901 (GRCm39) Y131H probably damaging Het
Ttbk2 T C 2: 120,586,319 (GRCm39) I466V probably benign Het
Ttn T C 2: 76,576,157 (GRCm39) D24912G probably damaging Het
Utp20 A T 10: 88,603,323 (GRCm39) N1843K probably damaging Het
Vmn1r20 A G 6: 57,409,285 (GRCm39) R204G probably damaging Het
Vps18 A T 2: 119,124,423 (GRCm39) Q450L probably benign Het
Zbtb4 A G 11: 69,667,289 (GRCm39) E198G probably benign Het
Other mutations in Il10ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Il10ra APN 9 45,178,458 (GRCm39) missense probably damaging 1.00
IGL01916:Il10ra APN 9 45,167,444 (GRCm39) missense probably damaging 1.00
IGL03067:Il10ra APN 9 45,167,157 (GRCm39) missense probably benign 0.01
R0081:Il10ra UTSW 9 45,167,247 (GRCm39) missense probably benign 0.04
R0266:Il10ra UTSW 9 45,176,950 (GRCm39) missense probably benign 0.11
R1901:Il10ra UTSW 9 45,167,654 (GRCm39) missense probably benign 0.39
R1991:Il10ra UTSW 9 45,167,109 (GRCm39) missense probably benign 0.28
R2103:Il10ra UTSW 9 45,167,109 (GRCm39) missense probably benign 0.28
R2218:Il10ra UTSW 9 45,176,914 (GRCm39) missense probably benign
R4686:Il10ra UTSW 9 45,180,357 (GRCm39) missense probably damaging 1.00
R4908:Il10ra UTSW 9 45,166,919 (GRCm39) missense probably benign 0.21
R4982:Il10ra UTSW 9 45,180,357 (GRCm39) missense probably damaging 1.00
R5590:Il10ra UTSW 9 45,176,924 (GRCm39) nonsense probably null
R5739:Il10ra UTSW 9 45,167,368 (GRCm39) missense possibly damaging 0.65
R5872:Il10ra UTSW 9 45,166,951 (GRCm39) missense possibly damaging 0.92
R6053:Il10ra UTSW 9 45,167,601 (GRCm39) missense probably damaging 0.99
R6282:Il10ra UTSW 9 45,171,703 (GRCm39) missense probably damaging 0.98
R6798:Il10ra UTSW 9 45,167,730 (GRCm39) missense probably damaging 0.99
R7060:Il10ra UTSW 9 45,167,522 (GRCm39) missense probably benign 0.00
R7561:Il10ra UTSW 9 45,167,117 (GRCm39) missense probably benign 0.00
R7630:Il10ra UTSW 9 45,167,369 (GRCm39) missense probably damaging 1.00
R7709:Il10ra UTSW 9 45,171,697 (GRCm39) missense probably benign 0.01
R8880:Il10ra UTSW 9 45,175,631 (GRCm39) missense probably damaging 1.00
R8939:Il10ra UTSW 9 45,177,802 (GRCm39) missense unknown
R9069:Il10ra UTSW 9 45,167,396 (GRCm39) missense probably damaging 0.98
R9511:Il10ra UTSW 9 45,167,690 (GRCm39) missense probably benign 0.06
Z1176:Il10ra UTSW 9 45,177,930 (GRCm39) missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGGGCAAACCTCCAACTTTCTATGC -3'
(R):5'- ATACCCATCAGGACCAGGATGACAG -3'

Sequencing Primer
(F):5'- AGTGACCACTCTTCGGTCAG -3'
(R):5'- GACCAGGATGACAGTGACG -3'
Posted On 2014-05-23