Mutagenetix > Incidental Mutation

Incidental Mutation 'R1734:Atp2c1'

199580

Institutional Source

Beutler Lab

Gene Symbol

Atp2c1

Ensembl Gene

ENSMUSG00000032570

Gene Name

ATPase, Ca++-sequestering

Synonyms

D930003G21Rik, SPCA, ATP2C1A, PMR1, 1700121J11Rik

MMRRC Submission

039766-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.308) question?

Stock #

R1734 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

105403539-105527319 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 105414655 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 733 (T733A)

Ref Sequence

ENSEMBL: ENSMUSP00000135802 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000038118] [ENSMUST00000085133] [ENSMUST00000112558] [ENSMUST00000176770] [ENSMUST00000177074] [ENSMUST00000177293] [ENSMUST00000189758]

AlphaFold

Q80XR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000038118
AA Change: T869A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039103
Gene: ENSMUSG00000032570
AA Change: T869A

Domain	Start	End	E-Value	Type
Cation_ATPase_N	25	99	1.85e-14	SMART
Pfam:E1-E2_ATPase	105	339	2.3e-75	PFAM
Pfam:Hydrolase	343	655	2.9e-31	PFAM
Pfam:HAD	346	652	7.7e-15	PFAM
Pfam:Hydrolase_like2	408	492	9.5e-20	PFAM
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cation_ATPase_C	725	897	4e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000085133
AA Change: T903A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000082220
Gene: ENSMUSG00000032570
AA Change: T903A

Domain	Start	End	E-Value	Type
Cation_ATPase_N	59	133	1.85e-14	SMART
Pfam:E1-E2_ATPase	138	372	3.4e-62	PFAM
Pfam:Hydrolase	377	689	2.6e-23	PFAM
Pfam:HAD	380	686	7.8e-14	PFAM
Pfam:Cation_ATPase	442	526	3.2e-19	PFAM
low complexity region	740	755	N/A	INTRINSIC
Pfam:Cation_ATPase_C	759	931	3.8e-48	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000112557

Predicted Effect

probably damaging
Transcript: ENSMUST00000112558
AA Change: T869A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108177
Gene: ENSMUSG00000032570
AA Change: T869A

Domain	Start	End	E-Value	Type
Cation_ATPase_N	25	99	1.85e-14	SMART
Pfam:E1-E2_ATPase	105	339	2.3e-75	PFAM
Pfam:Hydrolase	343	655	2.9e-31	PFAM
Pfam:HAD	346	652	7.7e-15	PFAM
Pfam:Hydrolase_like2	408	492	9.5e-20	PFAM
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cation_ATPase_C	725	897	4e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000175697

Predicted Effect

probably damaging
Transcript: ENSMUST00000176770
AA Change: T864A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134764
Gene: ENSMUSG00000032570
AA Change: T864A

Domain	Start	End	E-Value	Type
Pfam:E1-E2_ATPase	100	334	8.9e-76	PFAM
Pfam:Hydrolase	338	650	1.1e-31	PFAM
Pfam:HAD	341	647	2.7e-15	PFAM
Pfam:Hydrolase_like2	403	487	4.8e-20	PFAM
low complexity region	701	716	N/A	INTRINSIC
Pfam:Cation_ATPase_C	720	892	1.6e-47	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000177074
AA Change: T869A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135646
Gene: ENSMUSG00000032570
AA Change: T869A

Domain	Start	End	E-Value	Type
Cation_ATPase_N	25	99	1.85e-14	SMART
Pfam:E1-E2_ATPase	105	339	8.2e-76	PFAM
Pfam:Hydrolase	343	655	1e-31	PFAM
Pfam:HAD	346	652	2.5e-15	PFAM
Pfam:Hydrolase_like2	408	492	4.5e-20	PFAM
low complexity region	706	721	N/A	INTRINSIC
Pfam:Cation_ATPase_C	725	886	7e-44	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000177293
AA Change: T733A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135802
Gene: ENSMUSG00000032570
AA Change: T733A

Domain	Start	End	E-Value	Type
Pfam:E1-E2_ATPase	1	203	6.7e-64	PFAM
Pfam:Hydrolase	207	519	7.4e-32	PFAM
Pfam:HAD	210	516	1.9e-15	PFAM
Pfam:Hydrolase_like2	272	356	3.8e-20	PFAM
transmembrane domain	564	586	N/A	INTRINSIC
Pfam:Cation_ATPase_C	589	761	1.2e-47	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000189758

SMART Domains

Protein: ENSMUSP00000139854
Gene: ENSMUSG00000032567

Domain	Start	End	E-Value	Type
low complexity region	59	71	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000190934

Meta Mutation Damage Score

0.9202

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 92.9%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases. This magnesium-dependent enzyme catalyzes the hydrolysis of ATP coupled with the transport of calcium ions. Defects in this gene cause Hailey-Hailey disease, an autosomal dominant disorder. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele show embryonic growth retardation, failure of rostral neural tube closure, Golgi and endoplasmic reticulum stress, increased apoptosis, accumulation of intracellular lipid droplets and midgestational lethality. Agedheterozygotes develop squamous cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,585,460	C4695R	probably benign	Het
Actr10	T	A	12: 70,961,996	V401E	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Aimp1	A	T	3: 132,674,796	I59K	probably damaging	Het
Alms1	T	A	6: 85,641,550		probably null	Het
Anln	A	T	9: 22,350,955	S947T	possibly damaging	Het
BC049715	C	T	6: 136,840,308	P182L	probably damaging	Het
Cblb	T	C	16: 52,186,240		probably benign	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Chac1	A	T	2: 119,353,458	L180F	probably damaging	Het
Cherp	A	T	8: 72,470,088		probably null	Het
Ckap4	A	G	10: 84,527,874	S442P	probably benign	Het
Clstn3	G	A	6: 124,436,814		probably benign	Het
Crb2	T	A	2: 37,793,656	C1057S	probably damaging	Het
Dact2	T	C	17: 14,196,639	D433G	probably benign	Het
Dnah6	G	A	6: 73,044,761	T3526M	probably damaging	Het
Ethe1	A	G	7: 24,608,384	T210A	probably benign	Het
Fat2	A	G	11: 55,281,371	S2839P	probably benign	Het
Fbxl7	T	C	15: 26,543,649	Y304C	probably damaging	Het
Gad1-ps	A	T	10: 99,445,775		noncoding transcript	Het
Gm436	A	T	4: 144,670,026	C379S	probably benign	Het
Grm3	C	T	5: 9,589,742	R101K	probably benign	Het
Hspa12b	A	G	2: 131,138,536	Y125C	possibly damaging	Het
Il10ra	T	C	9: 45,255,943	T437A	probably benign	Het
Jcad	T	C	18: 4,674,526	F763L	probably damaging	Het
Map3k10	T	C	7: 27,658,115	D746G	probably damaging	Het
Mettl9	T	A	7: 121,047,841	Y57N	probably damaging	Het
Nav2	G	A	7: 49,575,720	E1803K	probably damaging	Het
Nol11	G	A	11: 107,175,623	S447L	possibly damaging	Het
Olfr294	C	T	7: 86,616,217	V143M	probably benign	Het
Osbpl1a	T	C	18: 12,788,316		probably null	Het
Pde6a	A	G	18: 61,285,965	N804S	probably damaging	Het
Pepd	A	T	7: 35,031,426	D301V	probably benign	Het
Piwil2	A	T	14: 70,426,505		probably null	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Prrc2a	A	G	17: 35,150,707	S1877P	possibly damaging	Het
Retreg2	G	T	1: 75,142,986		probably null	Het
Slc7a11	G	A	3: 50,372,346	Q489*	probably null	Het
Sned1	G	A	1: 93,259,768	D256N	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Ssfa2	G	A	2: 79,657,822	V750M	probably damaging	Het
Syce2	G	A	8: 84,887,147	E168K	probably benign	Het
Tex37	T	A	6: 70,913,661	Q49L	probably benign	Het
Tmem260	G	T	14: 48,509,093	V609L	probably benign	Het
Trim35	A	G	14: 66,309,329	D515G	probably damaging	Het
Tspan5	T	C	3: 138,898,140	Y131H	probably damaging	Het
Ttbk2	T	C	2: 120,755,838	I466V	probably benign	Het
Ttn	T	C	2: 76,745,813	D24912G	probably damaging	Het
Utp20	A	T	10: 88,767,461	N1843K	probably damaging	Het
Vmn1r20	A	G	6: 57,432,300	R204G	probably damaging	Het
Vps18	A	T	2: 119,293,942	Q450L	probably benign	Het
Zbtb4	A	G	11: 69,776,463	E198G	probably benign	Het

Other mutations in Atp2c1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00984:Atp2c1	APN	9	105418579	missense	probably damaging	1.00
IGL01682:Atp2c1	APN	9	105452842	missense	probably damaging	1.00
IGL01874:Atp2c1	APN	9	105448825	missense	probably damaging	1.00
IGL02299:Atp2c1	APN	9	105461087	unclassified	probably benign
IGL03186:Atp2c1	APN	9	105413130	missense	probably benign	0.10
IGL03212:Atp2c1	APN	9	105445267	missense	probably damaging	1.00
BB002:Atp2c1	UTSW	9	105442770	missense	possibly damaging	0.92
BB012:Atp2c1	UTSW	9	105442770	missense	possibly damaging	0.92
IGL02799:Atp2c1	UTSW	9	105413043	unclassified	probably benign
IGL03047:Atp2c1	UTSW	9	105521007	intron	probably benign
R0885:Atp2c1	UTSW	9	105421573	critical splice donor site	probably null
R1072:Atp2c1	UTSW	9	105459744	missense	possibly damaging	0.92
R1469:Atp2c1	UTSW	9	105435152	nonsense	probably null
R1469:Atp2c1	UTSW	9	105435152	nonsense	probably null
R1611:Atp2c1	UTSW	9	105442852	missense	probably damaging	0.98
R1638:Atp2c1	UTSW	9	105432698	missense	probably damaging	0.96
R1667:Atp2c1	UTSW	9	105432797	missense	probably null	0.94
R1722:Atp2c1	UTSW	9	105439400	missense	probably benign	0.01
R1782:Atp2c1	UTSW	9	105431587	missense	probably damaging	0.99
R1964:Atp2c1	UTSW	9	105446123	missense	probably damaging	1.00
R2008:Atp2c1	UTSW	9	105432726	missense	probably benign	0.00
R2093:Atp2c1	UTSW	9	105418121	nonsense	probably null
R3720:Atp2c1	UTSW	9	105422976	missense	probably damaging	1.00
R4118:Atp2c1	UTSW	9	105466659	missense	probably damaging	1.00
R4273:Atp2c1	UTSW	9	105435140	missense	probably benign	0.10
R4763:Atp2c1	UTSW	9	105418567	missense	probably damaging	1.00
R4962:Atp2c1	UTSW	9	105442950	missense	probably benign	0.03
R5121:Atp2c1	UTSW	9	105448825	missense	probably damaging	1.00
R5458:Atp2c1	UTSW	9	105414725	nonsense	probably null
R5551:Atp2c1	UTSW	9	105459737	missense	probably damaging	1.00
R6198:Atp2c1	UTSW	9	105521072	missense	probably benign	0.00
R6414:Atp2c1	UTSW	9	105466656	missense	probably damaging	1.00
R6432:Atp2c1	UTSW	9	105445313	missense	probably damaging	1.00
R6675:Atp2c1	UTSW	9	105453533	critical splice donor site	probably null
R6719:Atp2c1	UTSW	9	105424178	missense	probably damaging	1.00
R6777:Atp2c1	UTSW	9	105418600	missense	possibly damaging	0.64
R6847:Atp2c1	UTSW	9	105418579	missense	probably damaging	1.00
R6870:Atp2c1	UTSW	9	105470062	missense	probably benign	0.13
R7097:Atp2c1	UTSW	9	105464651	missense	probably damaging	1.00
R7120:Atp2c1	UTSW	9	105420186	nonsense	probably null
R7216:Atp2c1	UTSW	9	105467731	missense	probably benign	0.00
R7284:Atp2c1	UTSW	9	105520809	splice site	probably null
R7365:Atp2c1	UTSW	9	105422999	missense	probably damaging	1.00
R7448:Atp2c1	UTSW	9	105452783	missense	probably damaging	0.98
R7818:Atp2c1	UTSW	9	105414757	missense	probably benign	0.06
R7921:Atp2c1	UTSW	9	105414687	missense	probably damaging	1.00
R7925:Atp2c1	UTSW	9	105442770	missense	possibly damaging	0.92
R8088:Atp2c1	UTSW	9	105452569	splice site	probably null
R8257:Atp2c1	UTSW	9	105431557	missense	probably benign	0.40
R8260:Atp2c1	UTSW	9	105418579	missense	probably damaging	1.00
R8265:Atp2c1	UTSW	9	105470116	missense	probably benign	0.01
R8307:Atp2c1	UTSW	9	105442831	missense	probably benign
R9052:Atp2c1	UTSW	9	105452833	missense	probably damaging	0.99
R9066:Atp2c1	UTSW	9	105453646	missense	probably damaging	1.00
R9177:Atp2c1	UTSW	9	105459659	critical splice donor site	probably null
R9257:Atp2c1	UTSW	9	105414652	nonsense	probably null
R9566:Atp2c1	UTSW	9	105466629	missense	probably damaging	0.97
R9779:Atp2c1	UTSW	9	105414720	missense	probably damaging	0.98
X0053:Atp2c1	UTSW	9	105418684	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTAATGCTGGACCACACAACGG -3'
(R):5'- GCCATTTCTGCTATCAGGGTGGAC -3'

Sequencing Primer
(F):5'- GCTAATGACTCCTGACTCAAATGG -3'
(R):5'- TGCCAACAGACCAAGTCTGT -3'

Posted On

2014-05-23