Incidental Mutation 'R1734:Zbtb4'
ID199587
Institutional Source Beutler Lab
Gene Symbol Zbtb4
Ensembl Gene ENSMUSG00000018750
Gene Namezinc finger and BTB domain containing 4
Synonyms9230111I22Rik, 2310026P19Rik
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69765912-69784023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69776463 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 198 (E198G)
Ref Sequence ENSEMBL: ENSMUSP00000104280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108638] [ENSMUST00000108639] [ENSMUST00000108640] [ENSMUST00000108642] [ENSMUST00000132528] [ENSMUST00000153943] [ENSMUST00000156932]
Predicted Effect probably benign
Transcript: ENSMUST00000108638
AA Change: E198G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000104278
Gene: ENSMUSG00000018750
AA Change: E198G

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108639
AA Change: E198G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104279
Gene: ENSMUSG00000018750
AA Change: E198G

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108640
AA Change: E198G

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000104280
Gene: ENSMUSG00000018750
AA Change: E198G

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108642
SMART Domains Protein: ENSMUSP00000104282
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132528
SMART Domains Protein: ENSMUSP00000121694
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 56 6.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153943
SMART Domains Protein: ENSMUSP00000118027
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 51 5.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156932
SMART Domains Protein: ENSMUSP00000115687
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 51 6e-8 PFAM
low complexity region 68 85 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Meta Mutation Damage Score 0.0832 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Other mutations in Zbtb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Zbtb4 APN 11 69776731 nonsense probably null
IGL02178:Zbtb4 APN 11 69776429 nonsense probably null
R0092:Zbtb4 UTSW 11 69779351 missense probably benign
R0403:Zbtb4 UTSW 11 69777639 missense probably damaging 0.99
R1276:Zbtb4 UTSW 11 69776219 missense probably damaging 1.00
R1654:Zbtb4 UTSW 11 69779169 missense probably damaging 0.98
R1762:Zbtb4 UTSW 11 69778917 missense probably benign 0.03
R2224:Zbtb4 UTSW 11 69776358 missense probably benign 0.43
R2930:Zbtb4 UTSW 11 69776516 nonsense probably null
R4670:Zbtb4 UTSW 11 69776529 missense probably damaging 0.97
R4998:Zbtb4 UTSW 11 69778671 missense probably benign 0.31
R5956:Zbtb4 UTSW 11 69778214 missense probably benign 0.29
R5988:Zbtb4 UTSW 11 69778964 missense probably damaging 1.00
R6115:Zbtb4 UTSW 11 69776322 missense probably damaging 1.00
R6237:Zbtb4 UTSW 11 69778243 missense possibly damaging 0.70
R6803:Zbtb4 UTSW 11 69778628 missense possibly damaging 0.92
R7395:Zbtb4 UTSW 11 69776111 missense possibly damaging 0.58
R7756:Zbtb4 UTSW 11 69778542 missense probably benign 0.27
R7758:Zbtb4 UTSW 11 69778542 missense probably benign 0.27
R7877:Zbtb4 UTSW 11 69776037 missense probably benign 0.39
R8215:Zbtb4 UTSW 11 69778772 missense probably benign 0.00
R8306:Zbtb4 UTSW 11 69777483 missense probably damaging 1.00
R8407:Zbtb4 UTSW 11 69778275 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCTATAGTGCCCGGCTTGCACTC -3'
(R):5'- GGCAAACACCTTCTCACAGTAGCG -3'

Sequencing Primer
(F):5'- CGGCTTGCACTCCCTGG -3'
(R):5'- TTCACCACATGCTCAGGG -3'
Posted On2014-05-23