Mutagenetix > Incidental Mutation

Incidental Mutation 'R1734:Trim35'

199592

Institutional Source

Beutler Lab

Gene Symbol

Trim35

Ensembl Gene

ENSMUSG00000022043

Gene Name

tripartite motif-containing 35

Synonyms

Hls5, Mair, A430106H13Rik, 0710005M05Rik

MMRRC Submission

039766-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.087) question?

Stock #

R1734 (G1)

Quality Score

155

Status

Validated

Chromosome

Chromosomal Location

66297031-66311424 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 66309329 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 515 (D515G)

Ref Sequence

ENSEMBL: ENSMUSP00000022623 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022623]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000022623
AA Change: D515G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000022623
Gene: ENSMUSG00000022043
AA Change: D515G

Domain	Start	End	E-Value	Type
low complexity region	3	15	N/A	INTRINSIC
low complexity region	18	29	N/A	INTRINSIC
RING	36	75	6.89e-8	SMART
BBOX	111	152	1.27e-6	SMART
coiled coil region	219	267	N/A	INTRINSIC
PRY	316	367	4.41e-15	SMART
Pfam:SPRY	370	495	3.5e-11	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000121006

SMART Domains

Protein: ENSMUSP00000112877
Gene: ENSMUSG00000022043

Domain	Start	End	E-Value	Type
low complexity region	12	23	N/A	INTRINSIC
RING	30	69	6.89e-8	SMART
BBOX	105	146	1.27e-6	SMART
coiled coil region	212	260	N/A	INTRINSIC
low complexity region	330	343	N/A	INTRINSIC

Meta Mutation Damage Score

0.0867

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 92.9%

Validation Efficiency

98% (59/60)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	C	11: 9,585,460	C4695R	probably benign	Het
Actr10	T	A	12: 70,961,996	V401E	probably benign	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Aimp1	A	T	3: 132,674,796	I59K	probably damaging	Het
Alms1	T	A	6: 85,641,550		probably null	Het
Anln	A	T	9: 22,350,955	S947T	possibly damaging	Het
Atp2c1	T	C	9: 105,414,655	T733A	probably damaging	Het
BC049715	C	T	6: 136,840,308	P182L	probably damaging	Het
Cblb	T	C	16: 52,186,240		probably benign	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Chac1	A	T	2: 119,353,458	L180F	probably damaging	Het
Cherp	A	T	8: 72,470,088		probably null	Het
Ckap4	A	G	10: 84,527,874	S442P	probably benign	Het
Clstn3	G	A	6: 124,436,814		probably benign	Het
Crb2	T	A	2: 37,793,656	C1057S	probably damaging	Het
Dact2	T	C	17: 14,196,639	D433G	probably benign	Het
Dnah6	G	A	6: 73,044,761	T3526M	probably damaging	Het
Ethe1	A	G	7: 24,608,384	T210A	probably benign	Het
Fat2	A	G	11: 55,281,371	S2839P	probably benign	Het
Fbxl7	T	C	15: 26,543,649	Y304C	probably damaging	Het
Gad1-ps	A	T	10: 99,445,775		noncoding transcript	Het
Gm436	A	T	4: 144,670,026	C379S	probably benign	Het
Grm3	C	T	5: 9,589,742	R101K	probably benign	Het
Hspa12b	A	G	2: 131,138,536	Y125C	possibly damaging	Het
Il10ra	T	C	9: 45,255,943	T437A	probably benign	Het
Jcad	T	C	18: 4,674,526	F763L	probably damaging	Het
Map3k10	T	C	7: 27,658,115	D746G	probably damaging	Het
Mettl9	T	A	7: 121,047,841	Y57N	probably damaging	Het
Nav2	G	A	7: 49,575,720	E1803K	probably damaging	Het
Nol11	G	A	11: 107,175,623	S447L	possibly damaging	Het
Olfr294	C	T	7: 86,616,217	V143M	probably benign	Het
Osbpl1a	T	C	18: 12,788,316		probably null	Het
Pde6a	A	G	18: 61,285,965	N804S	probably damaging	Het
Pepd	A	T	7: 35,031,426	D301V	probably benign	Het
Piwil2	A	T	14: 70,426,505		probably null	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Prrc2a	A	G	17: 35,150,707	S1877P	possibly damaging	Het
Retreg2	G	T	1: 75,142,986		probably null	Het
Slc7a11	G	A	3: 50,372,346	Q489*	probably null	Het
Sned1	G	A	1: 93,259,768	D256N	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Ssfa2	G	A	2: 79,657,822	V750M	probably damaging	Het
Syce2	G	A	8: 84,887,147	E168K	probably benign	Het
Tex37	T	A	6: 70,913,661	Q49L	probably benign	Het
Tmem260	G	T	14: 48,509,093	V609L	probably benign	Het
Tspan5	T	C	3: 138,898,140	Y131H	probably damaging	Het
Ttbk2	T	C	2: 120,755,838	I466V	probably benign	Het
Ttn	T	C	2: 76,745,813	D24912G	probably damaging	Het
Utp20	A	T	10: 88,767,461	N1843K	probably damaging	Het
Vmn1r20	A	G	6: 57,432,300	R204G	probably damaging	Het
Vps18	A	T	2: 119,293,942	Q450L	probably benign	Het
Zbtb4	A	G	11: 69,776,463	E198G	probably benign	Het

Other mutations in Trim35

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01652:Trim35	APN	14	66308801	missense	probably damaging	1.00
IGL02398:Trim35	APN	14	66309248	missense	probably damaging	1.00
IGL03132:Trim35	APN	14	66309146	missense	probably damaging	1.00
R0759:Trim35	UTSW	14	66308787	missense	probably benign	0.02
R0799:Trim35	UTSW	14	66309201	missense	probably damaging	1.00
R0848:Trim35	UTSW	14	66309125	missense	probably benign	0.01
R1170:Trim35	UTSW	14	66308799	missense	probably benign	0.35
R1751:Trim35	UTSW	14	66304168	missense	probably damaging	0.97
R1767:Trim35	UTSW	14	66304168	missense	probably damaging	0.97
R2259:Trim35	UTSW	14	66309262	nonsense	probably null
R3963:Trim35	UTSW	14	66304054	missense	probably damaging	1.00
R4572:Trim35	UTSW	14	66307873	missense	probably damaging	1.00
R5068:Trim35	UTSW	14	66308972	unclassified	probably benign
R5069:Trim35	UTSW	14	66308972	unclassified	probably benign
R5070:Trim35	UTSW	14	66308972	unclassified	probably benign
R5372:Trim35	UTSW	14	66297266	missense	possibly damaging	0.69
R5886:Trim35	UTSW	14	66304053	missense	possibly damaging	0.92
R5886:Trim35	UTSW	14	66304054	missense	probably damaging	1.00
R6018:Trim35	UTSW	14	66308750	missense	probably damaging	1.00
R6165:Trim35	UTSW	14	66309205	missense	probably damaging	1.00
R6326:Trim35	UTSW	14	66303204	missense	possibly damaging	0.52
R6476:Trim35	UTSW	14	66308795	missense	probably damaging	1.00
R7084:Trim35	UTSW	14	66308822	missense	probably damaging	0.98
R7192:Trim35	UTSW	14	66297446	missense	probably damaging	1.00
R7350:Trim35	UTSW	14	66309205	missense	probably damaging	1.00
R7546:Trim35	UTSW	14	66303247	missense	probably benign	0.02
R7644:Trim35	UTSW	14	66297097	missense	unknown
R7916:Trim35	UTSW	14	66308860	missense	probably damaging	1.00
R8406:Trim35	UTSW	14	66297275	missense	possibly damaging	0.91
R8524:Trim35	UTSW	14	66307044	missense	probably damaging	1.00
R8710:Trim35	UTSW	14	66307918	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTTCTATGACTCTGAGCGCCACTG -3'
(R):5'- CACCCACAACTCTGAGCTGTATTCC -3'

Sequencing Primer
(F):5'- TGAGCGCCACTGCCATC -3'
(R):5'- acaaatagactcaataagaggcatc -3'

Posted On

2014-05-23