Incidental Mutation 'R1734:Trim35'
ID 199592
Institutional Source Beutler Lab
Gene Symbol Trim35
Ensembl Gene ENSMUSG00000022043
Gene Name tripartite motif-containing 35
Synonyms Hls5, Mair, A430106H13Rik, 0710005M05Rik
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock # R1734 (G1)
Quality Score 155
Status Validated
Chromosome 14
Chromosomal Location 66297031-66311424 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66309329 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 515 (D515G)
Ref Sequence ENSEMBL: ENSMUSP00000022623 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022623]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000022623
AA Change: D515G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022623
Gene: ENSMUSG00000022043
AA Change: D515G

low complexity region 3 15 N/A INTRINSIC
low complexity region 18 29 N/A INTRINSIC
RING 36 75 6.89e-8 SMART
BBOX 111 152 1.27e-6 SMART
coiled coil region 219 267 N/A INTRINSIC
PRY 316 367 4.41e-15 SMART
Pfam:SPRY 370 495 3.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121006
SMART Domains Protein: ENSMUSP00000112877
Gene: ENSMUSG00000022043

low complexity region 12 23 N/A INTRINSIC
RING 30 69 6.89e-8 SMART
BBOX 105 146 1.27e-6 SMART
coiled coil region 212 260 N/A INTRINSIC
low complexity region 330 343 N/A INTRINSIC
Meta Mutation Damage Score 0.0867 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Trim35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01652:Trim35 APN 14 66308801 missense probably damaging 1.00
IGL02398:Trim35 APN 14 66309248 missense probably damaging 1.00
IGL03132:Trim35 APN 14 66309146 missense probably damaging 1.00
R0759:Trim35 UTSW 14 66308787 missense probably benign 0.02
R0799:Trim35 UTSW 14 66309201 missense probably damaging 1.00
R0848:Trim35 UTSW 14 66309125 missense probably benign 0.01
R1170:Trim35 UTSW 14 66308799 missense probably benign 0.35
R1751:Trim35 UTSW 14 66304168 missense probably damaging 0.97
R1767:Trim35 UTSW 14 66304168 missense probably damaging 0.97
R2259:Trim35 UTSW 14 66309262 nonsense probably null
R3963:Trim35 UTSW 14 66304054 missense probably damaging 1.00
R4572:Trim35 UTSW 14 66307873 missense probably damaging 1.00
R5068:Trim35 UTSW 14 66308972 unclassified probably benign
R5069:Trim35 UTSW 14 66308972 unclassified probably benign
R5070:Trim35 UTSW 14 66308972 unclassified probably benign
R5372:Trim35 UTSW 14 66297266 missense possibly damaging 0.69
R5886:Trim35 UTSW 14 66304053 missense possibly damaging 0.92
R5886:Trim35 UTSW 14 66304054 missense probably damaging 1.00
R6018:Trim35 UTSW 14 66308750 missense probably damaging 1.00
R6165:Trim35 UTSW 14 66309205 missense probably damaging 1.00
R6326:Trim35 UTSW 14 66303204 missense possibly damaging 0.52
R6476:Trim35 UTSW 14 66308795 missense probably damaging 1.00
R7084:Trim35 UTSW 14 66308822 missense probably damaging 0.98
R7192:Trim35 UTSW 14 66297446 missense probably damaging 1.00
R7350:Trim35 UTSW 14 66309205 missense probably damaging 1.00
R7546:Trim35 UTSW 14 66303247 missense probably benign 0.02
R7644:Trim35 UTSW 14 66297097 missense unknown
R7916:Trim35 UTSW 14 66308860 missense probably damaging 1.00
R8406:Trim35 UTSW 14 66297275 missense possibly damaging 0.91
R8524:Trim35 UTSW 14 66307044 missense probably damaging 1.00
R8710:Trim35 UTSW 14 66307918 missense probably damaging 0.99
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acaaatagactcaataagaggcatc -3'
Posted On 2014-05-23