Incidental Mutation 'R1734:Fbxl7'
ID 199594
Institutional Source Beutler Lab
Gene Symbol Fbxl7
Ensembl Gene ENSMUSG00000043556
Gene Name F-box and leucine-rich repeat protein 7
Synonyms D230018M15Rik, Fbl6, FBL7
MMRRC Submission 039766-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1734 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 26540459-26895580 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 26543649 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 304 (Y304C)
Ref Sequence ENSEMBL: ENSMUSP00000061305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059204]
AlphaFold Q5BJ29
Predicted Effect probably damaging
Transcript: ENSMUST00000059204
AA Change: Y304C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061305
Gene: ENSMUSG00000043556
AA Change: Y304C

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 73 79 N/A INTRINSIC
FBOX 117 157 2.7e-11 SMART
LRR_CC 185 210 2e-7 SMART
LRR_CC 211 236 2.1e-7 SMART
LRR 237 262 6.3e-7 SMART
LRR 271 296 3.5e-1 SMART
LRR_CC 297 322 1.7e-8 SMART
LRR_CC 323 348 5.5e-8 SMART
LRR_CC 349 374 6.5e-8 SMART
LRR_CC 375 400 9.1e-10 SMART
LRR_CC 401 426 2.1e-8 SMART
LRR_CC 427 452 1.8e-7 SMART
Blast:LRR 453 477 2e-7 BLAST
Meta Mutation Damage Score 0.5301 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by a 42-48 amino acid motif, the F-box, which binds to the S-phase kinase-associated protein 1 (Skp1) protein. The F-box proteins constitute one of the four subunits of E3 ubiquitin protein ligases called SCFs (SKP1-Cul1-F-box), which play a role in phosphorylation-dependent ubiquitination of proteins. The F-box proteins are divided into 3 subfamilies based on the other domain in the protein: F-box proteins that also have a WD-40 domain (Fbws subfamily), F-box proteins that also have leucine-rich repeats (Fbls subfamily) and F-box proteins that contain other motifs or lack known protein-interaction domains (Fbxs subfamily). The protein encoded by this gene belongs to the Fbls subfamily. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pde6a A G 18: 61,285,965 N804S probably damaging Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Fbxl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Fbxl7 APN 15 26789563 missense probably damaging 0.98
R0482:Fbxl7 UTSW 15 26543546 missense probably benign 0.06
R1826:Fbxl7 UTSW 15 26552765 missense possibly damaging 0.59
R1859:Fbxl7 UTSW 15 26543193 missense probably damaging 1.00
R2410:Fbxl7 UTSW 15 26895025 missense possibly damaging 0.79
R3703:Fbxl7 UTSW 15 26543755 missense probably damaging 1.00
R3704:Fbxl7 UTSW 15 26543755 missense probably damaging 1.00
R4025:Fbxl7 UTSW 15 26552819 missense probably benign 0.20
R4387:Fbxl7 UTSW 15 26543259 missense probably damaging 1.00
R5055:Fbxl7 UTSW 15 26552936 missense probably damaging 0.98
R5070:Fbxl7 UTSW 15 26789554 missense probably benign 0.15
R5180:Fbxl7 UTSW 15 26543421 missense probably damaging 1.00
R5260:Fbxl7 UTSW 15 26543499 missense probably damaging 1.00
R5720:Fbxl7 UTSW 15 26552893 missense probably damaging 0.98
R6256:Fbxl7 UTSW 15 26553002 missense probably benign 0.16
R6874:Fbxl7 UTSW 15 26552942 missense probably benign
R7143:Fbxl7 UTSW 15 26543158 missense probably benign
R7941:Fbxl7 UTSW 15 26543613 missense probably damaging 1.00
R8848:Fbxl7 UTSW 15 26552816 missense probably benign
R9211:Fbxl7 UTSW 15 26789530 missense probably damaging 0.99
R9402:Fbxl7 UTSW 15 26552503 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACAGTTCTTGGCGAGGTACTCCAC -3'
(R):5'- AAGTGACCTGCATCAGCTTGACC -3'

Sequencing Primer
(F):5'- GTATTTAGCCACATAACGAATGCC -3'
(R):5'- TGATATGACGGACTGCTTCG -3'
Posted On 2014-05-23