Incidental Mutation 'R1734:Pde6a'
ID199602
Institutional Source Beutler Lab
Gene Symbol Pde6a
Ensembl Gene ENSMUSG00000024575
Gene Namephosphodiesterase 6A, cGMP-specific, rod, alpha
SynonymsPdea
MMRRC Submission 039766-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1734 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location61220482-61289924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61285965 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 804 (N804S)
Ref Sequence ENSEMBL: ENSMUSP00000025468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025468]
Predicted Effect probably damaging
Transcript: ENSMUST00000025468
AA Change: N804S

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000025468
Gene: ENSMUSG00000024575
AA Change: N804S

DomainStartEndE-ValueType
GAF 73 232 1.36e-21 SMART
GAF 254 441 3.21e-23 SMART
low complexity region 478 495 N/A INTRINSIC
Blast:HDc 496 540 3e-11 BLAST
HDc 556 734 6.95e-8 SMART
Blast:HDc 759 786 1e-8 BLAST
low complexity region 817 837 N/A INTRINSIC
low complexity region 839 853 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000135688
AA Change: N125S
SMART Domains Protein: ENSMUSP00000115963
Gene: ENSMUSG00000024575
AA Change: N125S

DomainStartEndE-ValueType
Pfam:PDEase_I 8 125 1.1e-30 PFAM
low complexity region 139 159 N/A INTRINSIC
low complexity region 161 175 N/A INTRINSIC
Meta Mutation Damage Score 0.0908 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency 98% (59/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the cyclic-GMP (cGMP)-specific phosphodiesterase 6A alpha subunit, expressed in cells of the retinal rod outer segment. The phosphodiesterase 6 holoenzyme is a heterotrimer composed of an alpha, beta, and two gamma subunits. cGMP is an important regulator of rod cell membrane current, and its dynamic concentration is established by phosphodiesterase 6A cGMP hydrolysis and guanylate cyclase cGMP synthesis. The protein is a subunit of a key phototransduction enzyme and participates in processes of transmission and amplification of the visual signal. Mutations in this gene have been identified as one cause of autosomal recessive retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have retinal degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,585,460 C4695R probably benign Het
Actr10 T A 12: 70,961,996 V401E probably benign Het
Adamts16 G A 13: 70,779,518 probably benign Het
Aimp1 A T 3: 132,674,796 I59K probably damaging Het
Alms1 T A 6: 85,641,550 probably null Het
Anln A T 9: 22,350,955 S947T possibly damaging Het
Atp2c1 T C 9: 105,414,655 T733A probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Cblb T C 16: 52,186,240 probably benign Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Chac1 A T 2: 119,353,458 L180F probably damaging Het
Cherp A T 8: 72,470,088 probably null Het
Ckap4 A G 10: 84,527,874 S442P probably benign Het
Clstn3 G A 6: 124,436,814 probably benign Het
Crb2 T A 2: 37,793,656 C1057S probably damaging Het
Dact2 T C 17: 14,196,639 D433G probably benign Het
Dnah6 G A 6: 73,044,761 T3526M probably damaging Het
Ethe1 A G 7: 24,608,384 T210A probably benign Het
Fat2 A G 11: 55,281,371 S2839P probably benign Het
Fbxl7 T C 15: 26,543,649 Y304C probably damaging Het
Gad1-ps A T 10: 99,445,775 noncoding transcript Het
Gm436 A T 4: 144,670,026 C379S probably benign Het
Grm3 C T 5: 9,589,742 R101K probably benign Het
Hspa12b A G 2: 131,138,536 Y125C possibly damaging Het
Il10ra T C 9: 45,255,943 T437A probably benign Het
Jcad T C 18: 4,674,526 F763L probably damaging Het
Map3k10 T C 7: 27,658,115 D746G probably damaging Het
Mettl9 T A 7: 121,047,841 Y57N probably damaging Het
Nav2 G A 7: 49,575,720 E1803K probably damaging Het
Nol11 G A 11: 107,175,623 S447L possibly damaging Het
Olfr294 C T 7: 86,616,217 V143M probably benign Het
Osbpl1a T C 18: 12,788,316 probably null Het
Pepd A T 7: 35,031,426 D301V probably benign Het
Piwil2 A T 14: 70,426,505 probably null Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prrc2a A G 17: 35,150,707 S1877P possibly damaging Het
Retreg2 G T 1: 75,142,986 probably null Het
Slc7a11 G A 3: 50,372,346 Q489* probably null Het
Sned1 G A 1: 93,259,768 D256N probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Ssfa2 G A 2: 79,657,822 V750M probably damaging Het
Syce2 G A 8: 84,887,147 E168K probably benign Het
Tex37 T A 6: 70,913,661 Q49L probably benign Het
Tmem260 G T 14: 48,509,093 V609L probably benign Het
Trim35 A G 14: 66,309,329 D515G probably damaging Het
Tspan5 T C 3: 138,898,140 Y131H probably damaging Het
Ttbk2 T C 2: 120,755,838 I466V probably benign Het
Ttn T C 2: 76,745,813 D24912G probably damaging Het
Utp20 A T 10: 88,767,461 N1843K probably damaging Het
Vmn1r20 A G 6: 57,432,300 R204G probably damaging Het
Vps18 A T 2: 119,293,942 Q450L probably benign Het
Zbtb4 A G 11: 69,776,463 E198G probably benign Het
Other mutations in Pde6a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00583:Pde6a APN 18 61257268 missense probably damaging 1.00
IGL00896:Pde6a APN 18 61220792 missense possibly damaging 0.94
IGL01595:Pde6a APN 18 61281528 missense probably damaging 0.98
IGL02971:Pde6a APN 18 61264255 missense probably damaging 1.00
caffeinated UTSW 18 61220606 start codon destroyed probably null 0.95
R0219:Pde6a UTSW 18 61285935 missense possibly damaging 0.57
R0968:Pde6a UTSW 18 61253738 missense probably damaging 0.99
R1304:Pde6a UTSW 18 61258293 missense probably damaging 0.99
R1498:Pde6a UTSW 18 61232860 missense possibly damaging 0.73
R1542:Pde6a UTSW 18 61257045 missense possibly damaging 0.93
R1795:Pde6a UTSW 18 61257212 missense probably damaging 1.00
R2173:Pde6a UTSW 18 61254382 missense probably damaging 1.00
R2280:Pde6a UTSW 18 61262434 missense probably damaging 1.00
R2281:Pde6a UTSW 18 61262434 missense probably damaging 1.00
R3617:Pde6a UTSW 18 61231503 splice site probably benign
R4620:Pde6a UTSW 18 61262492 missense probably damaging 1.00
R4727:Pde6a UTSW 18 61231489 missense probably benign 0.02
R4863:Pde6a UTSW 18 61245592 missense probably damaging 1.00
R4904:Pde6a UTSW 18 61265034 missense probably benign 0.08
R4945:Pde6a UTSW 18 61234718 missense probably damaging 1.00
R4953:Pde6a UTSW 18 61231362 nonsense probably null
R5323:Pde6a UTSW 18 61232911 missense possibly damaging 0.81
R5496:Pde6a UTSW 18 61253665 critical splice acceptor site probably null
R5540:Pde6a UTSW 18 61231366 missense probably damaging 0.99
R6180:Pde6a UTSW 18 61284092 splice site probably null
R6366:Pde6a UTSW 18 61265071 splice site probably null
R6743:Pde6a UTSW 18 61263986 missense possibly damaging 0.48
R7161:Pde6a UTSW 18 61281525 missense probably benign 0.05
R7186:Pde6a UTSW 18 61220606 start codon destroyed probably null 0.95
R7197:Pde6a UTSW 18 61258224 missense probably damaging 0.96
R7296:Pde6a UTSW 18 61258293 missense probably damaging 0.99
R7487:Pde6a UTSW 18 61249960 missense probably damaging 1.00
R7734:Pde6a UTSW 18 61232866 missense probably benign 0.10
R7818:Pde6a UTSW 18 61281509 splice site probably null
R8104:Pde6a UTSW 18 61231494 missense probably damaging 0.99
R8135:Pde6a UTSW 18 61285925 missense probably damaging 0.98
R8213:Pde6a UTSW 18 61220696 missense possibly damaging 0.94
R8266:Pde6a UTSW 18 61258213 missense probably damaging 1.00
R8429:Pde6a UTSW 18 61232844 missense probably damaging 0.98
RF018:Pde6a UTSW 18 61231403 missense possibly damaging 0.84
X0064:Pde6a UTSW 18 61264948 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGCTGCTGGAGACAAAGTG -3'
(R):5'- ACAGAATGGCGACCACAGTTCAAG -3'

Sequencing Primer
(F):5'- ATGTGGCAAAATCTGGTCCC -3'
(R):5'- AGTTCAAGCCCGCATGTC -3'
Posted On2014-05-23