Mutagenetix > Incidental Mutation

Incidental Mutation 'R1735:Rasal2'

199607

Institutional Source

Beutler Lab

Gene Symbol

Rasal2

Ensembl Gene

ENSMUSG00000070565

Gene Name

RAS protein activator like 2

Synonyms

A330066M24Rik

MMRRC Submission

039767-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1735 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

157135182-157412595 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 157174160 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 518 (Y518C)

Ref Sequence

ENSEMBL: ENSMUSP00000114964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000129880] [ENSMUST00000132699] [ENSMUST00000134543] [ENSMUST00000143358]

AlphaFold

E9PW37

Predicted Effect

probably damaging
Transcript: ENSMUST00000078308
AA Change: Y536C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: Y536C

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
PH	58	307	3.97e-8	SMART
C2	317	413	6.01e-10	SMART
RasGAP	423	767	4.56e-157	SMART
low complexity region	780	791	N/A	INTRINSIC
low complexity region	1063	1075	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
coiled coil region	1117	1236	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128538

Predicted Effect

probably benign
Transcript: ENSMUST00000129880

SMART Domains

Protein: ENSMUSP00000118367
Gene: ENSMUSG00000070565

Domain	Start	End	E-Value	Type
PH	128	243	8.46e-3	SMART
Pfam:C2	252	323	1.7e-7	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000132699
AA Change: Y518C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: Y518C

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
PH	40	289	1.7e-10	SMART
C2	299	395	4e-12	SMART
RasGAP	405	742	4.2e-153	SMART
low complexity region	755	766	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1059	1067	N/A	INTRINSIC
coiled coil region	1092	1211	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000134543

SMART Domains

Protein: ENSMUSP00000119623
Gene: ENSMUSG00000070565

Domain	Start	End	E-Value	Type
PH	45	160	8.46e-3	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000143358

SMART Domains

Protein: ENSMUSP00000116974
Gene: ENSMUSG00000070565

Domain	Start	End	E-Value	Type
Blast:PH	1	147	2e-83	BLAST

Coding Region Coverage

1x: 97.6%
3x: 97.0%
10x: 95.3%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	A	C	9: 8,027,265	S91A	probably benign	Het
Acot5	A	T	12: 84,075,487	I282F	probably benign	Het
Adam19	C	A	11: 46,138,917	Q730K	probably benign	Het
Adgrv1	A	G	13: 81,487,947	V3481A	possibly damaging	Het
Akr1c20	T	C	13: 4,487,208	D316G	probably benign	Het
Ap3b1	G	A	13: 94,493,717	V827I	unknown	Het
Aph1a	T	A	3: 95,895,509	D140E	probably damaging	Het
Arhgef19	G	T	4: 141,249,618	V502L	possibly damaging	Het
Arl9	T	C	5: 77,006,626	F67S	probably damaging	Het
B430305J03Rik	G	A	3: 61,363,940		probably benign	Het
B4galnt2	A	G	11: 95,890,983	F119L	probably damaging	Het
Bcap29	T	A	12: 31,630,840	N49I	probably damaging	Het
C77080	G	T	4: 129,223,577	S476R	probably damaging	Het
Capn11	T	A	17: 45,632,401	K616*	probably null	Het
Cdh12	T	A	15: 21,520,366	Y306N	probably damaging	Het
Cep350	T	A	1: 155,953,214	N315Y	probably damaging	Het
Cited2	C	A	10: 17,724,046	P34Q	probably damaging	Het
Cmya5	A	T	13: 93,089,789	D2930E	probably benign	Het
Cog3	T	A	14: 75,729,321	K470*	probably null	Het
Commd10	A	G	18: 46,990,485	T136A	probably benign	Het
Csf2ra	C	A	19: 61,226,344	D181Y	probably damaging	Het
Csmd1	T	A	8: 15,932,610	I2686F	probably damaging	Het
Dhx29	T	C	13: 112,945,086	S415P	probably benign	Het
Dsel	A	T	1: 111,860,915	F630Y	probably damaging	Het
Ell	T	A	8: 70,578,940	I96N	possibly damaging	Het
Ephx2	T	A	14: 66,088,303	I358L	probably benign	Het
Fam162b	A	G	10: 51,587,211	I120T	probably damaging	Het
Fam187a	T	C	11: 102,885,780	Y137H	probably damaging	Het
Fastk	T	C	5: 24,441,803	E403G	probably damaging	Het
Fcrlb	C	A	1: 170,907,332	V409F	probably benign	Het
Flot2	G	T	11: 78,058,005	A269S	probably benign	Het
Gpd2	T	A	2: 57,355,551	N419K	probably damaging	Het
Hecw1	A	T	13: 14,377,765	M61K	probably null	Het
Htr2a	T	C	14: 74,706,128	F383L	probably damaging	Het
Kctd6	C	T	14: 8,222,253	R32C	probably damaging	Het
Khdc1a	A	G	1: 21,350,965	T125A	probably benign	Het
Klhl40	T	C	9: 121,779,938	S390P	probably benign	Het
Lonp1	G	A	17: 56,614,956	T808I	probably damaging	Het
Loxhd1	A	C	18: 77,404,889	D1342A	probably damaging	Het
Lrat	T	C	3: 82,897,110	I187V	probably benign	Het
Lrif1	T	C	3: 106,735,846	*238Q	probably null	Het
Lrp2bp	T	C	8: 46,011,988	F48S	probably benign	Het
Mafg	A	G	11: 120,629,678	M32T	possibly damaging	Het
Map4	C	T	9: 110,034,955	T416I	probably benign	Het
N4bp2	T	C	5: 65,808,316	F1236S	probably damaging	Het
Nfatc3	A	G	8: 106,083,834	D414G	probably damaging	Het
Nrip2	T	G	6: 128,405,074	V50G	probably damaging	Het
Olfr1449	T	A	19: 12,934,843	I35N	probably damaging	Het
Olfr16	A	G	1: 172,956,807	N4S	probably benign	Het
Olfr432	A	T	1: 174,050,799	K142I	probably benign	Het
Olfr608	T	A	7: 103,470,146	F36I	possibly damaging	Het
Pcdhb18	A	T	18: 37,490,769	H384L	probably benign	Het
Pik3r1	A	T	13: 101,686,374	Y607N	probably damaging	Het
Plagl2	G	A	2: 153,232,477	T168I	probably damaging	Het
Polr2a	A	G	11: 69,742,396	S912P	probably damaging	Het
Ppp1r16b	A	G	2: 158,761,495	K447E	possibly damaging	Het
Prkd1	T	C	12: 50,342,039	E907G	possibly damaging	Het
Rabep2	A	G	7: 126,444,540	R470G	probably damaging	Het
Rbmxl1	A	G	8: 78,506,082	Y211H	probably damaging	Het
Rdh7	T	C	10: 127,884,585	Y306C	probably benign	Het
Rtn3	T	C	19: 7,457,911	I220V	probably damaging	Het
Scn8a	A	G	15: 101,015,861	N1045D	possibly damaging	Het
Scube1	T	C	15: 83,607,437	H952R	probably damaging	Het
Sf3b1	A	G	1: 55,000,652	I690T	probably damaging	Het
Sharpin	T	C	15: 76,347,936	K240R	probably benign	Het
Skint5	A	G	4: 113,563,459	I1108T	unknown	Het
Snip1	A	G	4: 125,071,201	D133G	probably benign	Het
St3gal3	T	C	4: 118,014,774	Y77C	probably damaging	Het
Sytl3	T	C	17: 6,715,481	V112A	probably benign	Het
Tnxb	C	T	17: 34,717,970	P3718S	probably damaging	Het
Ttc24	A	T	3: 88,073,094		probably null	Het
Ubr3	A	T	2: 70,009,129	E1529V	probably damaging	Het
Utrn	T	A	10: 12,710,138	H965L	probably benign	Het
Xrn2	T	A	2: 147,061,423	L781Q	probably damaging	Het
Zbtb11	T	C	16: 55,990,682	I401T	probably benign	Het
Zc3h14	C	T	12: 98,758,580	P167L	probably damaging	Het
Zfp609	G	T	9: 65,703,092	S863*	probably null	Het

Other mutations in Rasal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Rasal2	APN	1	157147817	missense	probably benign
IGL00484:Rasal2	APN	1	157174175	splice site	probably null
IGL00731:Rasal2	APN	1	157157764	missense	probably benign	0.01
IGL00900:Rasal2	APN	1	157411929	missense	possibly damaging	0.73
IGL01346:Rasal2	APN	1	157161216	missense	probably benign	0.19
IGL01635:Rasal2	APN	1	157163824	missense	probably damaging	1.00
IGL01759:Rasal2	APN	1	157175932	missense	probably benign	0.42
IGL01939:Rasal2	APN	1	157175910	missense	probably damaging	1.00
IGL01954:Rasal2	APN	1	157177699	missense	possibly damaging	0.83
IGL01954:Rasal2	APN	1	157176116	missense	probably damaging	0.99
IGL02005:Rasal2	APN	1	157156998	nonsense	probably null
IGL02056:Rasal2	APN	1	157299261	missense	probably damaging	0.99
IGL02444:Rasal2	APN	1	157299195	missense	probably benign	0.20
IGL02496:Rasal2	APN	1	157149879	missense	possibly damaging	0.69
IGL02832:Rasal2	APN	1	157157207	missense	probably damaging	1.00
IGL03351:Rasal2	APN	1	157192741	splice site	probably benign
R0456:Rasal2	UTSW	1	157149843	missense	probably damaging	1.00
R0537:Rasal2	UTSW	1	157147792	missense	possibly damaging	0.46
R0681:Rasal2	UTSW	1	157157180	missense	possibly damaging	0.70
R0682:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0683:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0787:Rasal2	UTSW	1	157158696	missense	probably damaging	1.00
R0789:Rasal2	UTSW	1	157157321	missense	probably damaging	1.00
R1109:Rasal2	UTSW	1	157177638	unclassified	probably benign
R1175:Rasal2	UTSW	1	157147648	missense	probably damaging	1.00
R1332:Rasal2	UTSW	1	157175821	missense	probably benign	0.00
R1396:Rasal2	UTSW	1	157164666	missense	probably damaging	1.00
R1535:Rasal2	UTSW	1	157230059	missense	probably benign	0.28
R1542:Rasal2	UTSW	1	157175851	missense	possibly damaging	0.84
R1703:Rasal2	UTSW	1	157157600	missense	probably damaging	1.00
R1762:Rasal2	UTSW	1	157299144	missense	possibly damaging	0.52
R2570:Rasal2	UTSW	1	157161300	missense	possibly damaging	0.85
R3148:Rasal2	UTSW	1	157243764	intron	probably benign
R3157:Rasal2	UTSW	1	157158655	splice site	probably benign
R4277:Rasal2	UTSW	1	157157126	missense	possibly damaging	0.46
R4459:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4460:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4563:Rasal2	UTSW	1	157175991	missense	probably damaging	1.00
R4672:Rasal2	UTSW	1	157243661	missense	probably benign	0.10
R4894:Rasal2	UTSW	1	157192804	missense	probably damaging	0.97
R5147:Rasal2	UTSW	1	157175694	missense	probably damaging	1.00
R5387:Rasal2	UTSW	1	157157765	missense	possibly damaging	0.81
R5421:Rasal2	UTSW	1	157299141	missense	probably benign	0.37
R5459:Rasal2	UTSW	1	157157661	missense	probably damaging	0.99
R5651:Rasal2	UTSW	1	157157381	missense	probably damaging	1.00
R5767:Rasal2	UTSW	1	157176162	missense	probably damaging	1.00
R5778:Rasal2	UTSW	1	157161290	missense	probably damaging	1.00
R6298:Rasal2	UTSW	1	157411862	missense	possibly damaging	0.85
R6332:Rasal2	UTSW	1	157299187	missense	probably damaging	1.00
R6571:Rasal2	UTSW	1	157161179	missense	possibly damaging	0.72
R7258:Rasal2	UTSW	1	157157700	missense	probably damaging	0.96
R7545:Rasal2	UTSW	1	157192769	missense	possibly damaging	0.93
R7558:Rasal2	UTSW	1	157175836	missense	probably damaging	0.99
R7894:Rasal2	UTSW	1	157243648	missense	probably benign	0.01
R8140:Rasal2	UTSW	1	157299235	missense	probably damaging	0.97
R8141:Rasal2	UTSW	1	157164670	missense	possibly damaging	0.89
R8151:Rasal2	UTSW	1	157243584	missense	probably damaging	0.96
R8218:Rasal2	UTSW	1	157157381	missense	probably damaging	0.99
R8517:Rasal2	UTSW	1	157146279	critical splice acceptor site	probably null
R9021:Rasal2	UTSW	1	157230944	missense	unknown
RF024:Rasal2	UTSW	1	157147790	missense	probably damaging	0.97
Z1177:Rasal2	UTSW	1	157175673	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAATGTGCTGGGAAGGACAGTTTAC -3'
(R):5'- ACCAGAGCCGAGAGGTTAGCATTAG -3'

Sequencing Primer
(F):5'- AAGGACAGTTTACAGTTGAAACC -3'
(R):5'- TTGAGAGCTGGCATTACATAAGC -3'

Posted On

2014-05-23