Incidental Mutation 'R1735:Olfr16'
ID199609
Institutional Source Beutler Lab
Gene Symbol Olfr16
Ensembl Gene ENSMUSG00000037924
Gene Nameolfactory receptor 16
SynonymsMOR23, MOR267-13, GA_x6K02T2R7CC-893157-892228
MMRRC Submission 039767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R1735 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172950409-172958357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172956807 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 4 (N4S)
Ref Sequence ENSEMBL: ENSMUSP00000149249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038432] [ENSMUST00000215254]
Predicted Effect probably benign
Transcript: ENSMUST00000038432
AA Change: N4S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041524
Gene: ENSMUSG00000037924
AA Change: N4S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 7.5e-51 PFAM
Pfam:7tm_1 41 289 3.4e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215254
AA Change: N4S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.0%
  • 10x: 95.3%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A C 9: 8,027,265 S91A probably benign Het
Acot5 A T 12: 84,075,487 I282F probably benign Het
Adam19 C A 11: 46,138,917 Q730K probably benign Het
Adgrv1 A G 13: 81,487,947 V3481A possibly damaging Het
Akr1c20 T C 13: 4,487,208 D316G probably benign Het
Ap3b1 G A 13: 94,493,717 V827I unknown Het
Aph1a T A 3: 95,895,509 D140E probably damaging Het
Arhgef19 G T 4: 141,249,618 V502L possibly damaging Het
Arl9 T C 5: 77,006,626 F67S probably damaging Het
B430305J03Rik G A 3: 61,363,940 probably benign Het
B4galnt2 A G 11: 95,890,983 F119L probably damaging Het
Bcap29 T A 12: 31,630,840 N49I probably damaging Het
C77080 G T 4: 129,223,577 S476R probably damaging Het
Capn11 T A 17: 45,632,401 K616* probably null Het
Cdh12 T A 15: 21,520,366 Y306N probably damaging Het
Cep350 T A 1: 155,953,214 N315Y probably damaging Het
Cited2 C A 10: 17,724,046 P34Q probably damaging Het
Cmya5 A T 13: 93,089,789 D2930E probably benign Het
Cog3 T A 14: 75,729,321 K470* probably null Het
Commd10 A G 18: 46,990,485 T136A probably benign Het
Csf2ra C A 19: 61,226,344 D181Y probably damaging Het
Csmd1 T A 8: 15,932,610 I2686F probably damaging Het
Dhx29 T C 13: 112,945,086 S415P probably benign Het
Dsel A T 1: 111,860,915 F630Y probably damaging Het
Ell T A 8: 70,578,940 I96N possibly damaging Het
Ephx2 T A 14: 66,088,303 I358L probably benign Het
Fam162b A G 10: 51,587,211 I120T probably damaging Het
Fam187a T C 11: 102,885,780 Y137H probably damaging Het
Fastk T C 5: 24,441,803 E403G probably damaging Het
Fcrlb C A 1: 170,907,332 V409F probably benign Het
Flot2 G T 11: 78,058,005 A269S probably benign Het
Gpd2 T A 2: 57,355,551 N419K probably damaging Het
Hecw1 A T 13: 14,377,765 M61K probably null Het
Htr2a T C 14: 74,706,128 F383L probably damaging Het
Kctd6 C T 14: 8,222,253 R32C probably damaging Het
Khdc1a A G 1: 21,350,965 T125A probably benign Het
Klhl40 T C 9: 121,779,938 S390P probably benign Het
Lonp1 G A 17: 56,614,956 T808I probably damaging Het
Loxhd1 A C 18: 77,404,889 D1342A probably damaging Het
Lrat T C 3: 82,897,110 I187V probably benign Het
Lrif1 T C 3: 106,735,846 *238Q probably null Het
Lrp2bp T C 8: 46,011,988 F48S probably benign Het
Mafg A G 11: 120,629,678 M32T possibly damaging Het
Map4 C T 9: 110,034,955 T416I probably benign Het
N4bp2 T C 5: 65,808,316 F1236S probably damaging Het
Nfatc3 A G 8: 106,083,834 D414G probably damaging Het
Nrip2 T G 6: 128,405,074 V50G probably damaging Het
Olfr1449 T A 19: 12,934,843 I35N probably damaging Het
Olfr432 A T 1: 174,050,799 K142I probably benign Het
Olfr608 T A 7: 103,470,146 F36I possibly damaging Het
Pcdhb18 A T 18: 37,490,769 H384L probably benign Het
Pik3r1 A T 13: 101,686,374 Y607N probably damaging Het
Plagl2 G A 2: 153,232,477 T168I probably damaging Het
Polr2a A G 11: 69,742,396 S912P probably damaging Het
Ppp1r16b A G 2: 158,761,495 K447E possibly damaging Het
Prkd1 T C 12: 50,342,039 E907G possibly damaging Het
Rabep2 A G 7: 126,444,540 R470G probably damaging Het
Rasal2 T C 1: 157,174,160 Y518C probably damaging Het
Rbmxl1 A G 8: 78,506,082 Y211H probably damaging Het
Rdh7 T C 10: 127,884,585 Y306C probably benign Het
Rtn3 T C 19: 7,457,911 I220V probably damaging Het
Scn8a A G 15: 101,015,861 N1045D possibly damaging Het
Scube1 T C 15: 83,607,437 H952R probably damaging Het
Sf3b1 A G 1: 55,000,652 I690T probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint5 A G 4: 113,563,459 I1108T unknown Het
Snip1 A G 4: 125,071,201 D133G probably benign Het
St3gal3 T C 4: 118,014,774 Y77C probably damaging Het
Sytl3 T C 17: 6,715,481 V112A probably benign Het
Tnxb C T 17: 34,717,970 P3718S probably damaging Het
Ttc24 A T 3: 88,073,094 probably null Het
Ubr3 A T 2: 70,009,129 E1529V probably damaging Het
Utrn T A 10: 12,710,138 H965L probably benign Het
Xrn2 T A 2: 147,061,423 L781Q probably damaging Het
Zbtb11 T C 16: 55,990,682 I401T probably benign Het
Zc3h14 C T 12: 98,758,580 P167L probably damaging Het
Zfp609 G T 9: 65,703,092 S863* probably null Het
Other mutations in Olfr16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Olfr16 APN 1 172957591 missense possibly damaging 0.66
IGL00336:Olfr16 APN 1 172957478 missense probably benign 0.30
IGL01155:Olfr16 APN 1 172956924 missense probably benign 0.43
IGL01549:Olfr16 APN 1 172956974 missense probably damaging 1.00
IGL02679:Olfr16 APN 1 172957176 missense probably damaging 1.00
IGL03071:Olfr16 APN 1 172956935 missense probably benign 0.01
IGL03352:Olfr16 APN 1 172957283 missense probably benign 0.00
R0449:Olfr16 UTSW 1 172957398 missense probably damaging 1.00
R1725:Olfr16 UTSW 1 172957341 missense possibly damaging 0.90
R1726:Olfr16 UTSW 1 172957091 missense probably benign 0.00
R1928:Olfr16 UTSW 1 172957314 missense probably damaging 0.98
R4258:Olfr16 UTSW 1 172957638 missense possibly damaging 0.88
R4359:Olfr16 UTSW 1 172957080 missense probably benign
R4434:Olfr16 UTSW 1 172957544 missense probably damaging 1.00
R4666:Olfr16 UTSW 1 172957590 missense probably benign
R4874:Olfr16 UTSW 1 172957599 missense probably benign 0.00
R5063:Olfr16 UTSW 1 172957442 missense possibly damaging 0.48
R5988:Olfr16 UTSW 1 172957156 nonsense probably null
R6074:Olfr16 UTSW 1 172957378 missense probably benign 0.10
R7021:Olfr16 UTSW 1 172956927 missense probably benign 0.01
R7234:Olfr16 UTSW 1 172957106 missense probably damaging 0.96
R7527:Olfr16 UTSW 1 172956944 missense probably benign 0.00
R8271:Olfr16 UTSW 1 172957177 nonsense probably null
Z1088:Olfr16 UTSW 1 172957324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCTCCTTGCAAAGGACATTTTGCC -3'
(R):5'- ACACAGTCTCTGAGCTTGCCAAC -3'

Sequencing Primer
(F):5'- GGACATTTTGCCAATGTTTATACAC -3'
(R):5'- GAGCTTGCCAACATGCTCAG -3'
Posted On2014-05-23