Mutagenetix > Incidental Mutation

Incidental Mutation 'R1735:Polr2a'

199652

Institutional Source

Beutler Lab

Gene Symbol

Polr2a

Ensembl Gene

ENSMUSG00000005198

Gene Name

polymerase (RNA) II (DNA directed) polypeptide A

Synonyms

Rpo2-1, 220kDa

MMRRC Submission

039767-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R1735 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

69733997-69758637 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 69742396 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 912 (S912P)

Ref Sequence

ENSEMBL: ENSMUSP00000071200 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058470] [ENSMUST00000071213]

AlphaFold

P08775

Predicted Effect

probably damaging
Transcript: ENSMUST00000058470
AA Change: S912P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000050771
Gene: ENSMUSG00000005198
AA Change: S912P

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	110	179	5e-37	BLAST
RPOLA_N	246	549	7.02e-203	SMART
Pfam:RNA_pol_Rpb1_4	716	823	3.6e-39	PFAM
Pfam:RNA_pol_Rpb1_5	830	1428	2e-101	PFAM
Pfam:RNA_pol_Rpb1_6	896	1079	1.7e-70	PFAM
Pfam:RNA_pol_Rpb1_7	1164	1299	1.7e-57	PFAM
Pfam:RNA_pol_Rpb1_R	1555	1568	2.1e-3	PFAM
Pfam:RNA_pol_Rpb1_R	1616	1629	8.8e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1630	1643	1.9e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1644	1657	2.3e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1658	1671	2.2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1672	1685	2.4e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1686	1699	2.5e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1700	1713	2.5e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1714	1727	2.5e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1728	1741	2.6e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1742	1755	5.3e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1757	1769	5.8e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1784	1797	2.6e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1798	1811	4.8e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1826	1839	4.3e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1841	1853	2e-3	PFAM
Pfam:RNA_pol_Rpb1_R	1854	1867	6.9e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1868	1881	3.7e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1882	1895	1.2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1896	1909	5e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1910	1923	2.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1924	1936	2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1931	1954	2.6e-3	PFAM
Pfam:RNA_pol_Rpb1_R	1948	1960	2.5e-3	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000071213
AA Change: S912P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000071200
Gene: ENSMUSG00000005198
AA Change: S912P

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	110	179	5e-37	BLAST
RPOLA_N	246	549	7.02e-203	SMART
Pfam:RNA_pol_Rpb1_4	716	823	1.8e-41	PFAM
Pfam:RNA_pol_Rpb1_5	830	1428	4.8e-104	PFAM
Pfam:RNA_pol_Rpb1_6	896	1079	5.2e-74	PFAM
Pfam:RNA_pol_Rpb1_7	1164	1299	1.4e-55	PFAM
low complexity region	1503	1522	N/A	INTRINSIC
low complexity region	1524	1549	N/A	INTRINSIC
Pfam:RNA_pol_Rpb1_R	1578	1591	2.7e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1592	1605	2.5e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1606	1619	2.7e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1620	1633	2.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1634	1647	2.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1648	1661	2.4e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1662	1675	2.4e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1676	1689	2.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1690	1703	2.3e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1704	1717	5.2e-7	PFAM
Pfam:RNA_pol_Rpb1_R	1718	1731	5.5e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1732	1745	1.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1746	1759	8.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1760	1773	2e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1788	1801	3.3e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1802	1815	2.4e-4	PFAM
Pfam:RNA_pol_Rpb1_R	1816	1829	8.3e-7	PFAM
Pfam:RNA_pol_Rpb1_R	1830	1843	2.2e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1844	1857	1.6e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1858	1871	2.8e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1872	1885	6e-7	PFAM
Pfam:RNA_pol_Rpb1_R	1886	1899	4.6e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1893	1909	4.8e-5	PFAM
Pfam:RNA_pol_Rpb1_R	1903	1916	2.8e-6	PFAM
Pfam:RNA_pol_Rpb1_R	1910	1923	1.6e-4	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151586

Coding Region Coverage

1x: 97.6%
3x: 97.0%
10x: 95.3%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a reporter allele show prenatal lethality. Homozygotes for a small deletion in the C-terminal domain are viable, fertile and developmentally normal. Homozygotes for a larger deletion show reduced fetal size and partial postnatal lethality; survivors are small but otherwise normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	A	C	9: 8,027,265	S91A	probably benign	Het
Acot5	A	T	12: 84,075,487	I282F	probably benign	Het
Adam19	C	A	11: 46,138,917	Q730K	probably benign	Het
Adgrv1	A	G	13: 81,487,947	V3481A	possibly damaging	Het
Akr1c20	T	C	13: 4,487,208	D316G	probably benign	Het
Ap3b1	G	A	13: 94,493,717	V827I	unknown	Het
Aph1a	T	A	3: 95,895,509	D140E	probably damaging	Het
Arhgef19	G	T	4: 141,249,618	V502L	possibly damaging	Het
Arl9	T	C	5: 77,006,626	F67S	probably damaging	Het
B430305J03Rik	G	A	3: 61,363,940		probably benign	Het
B4galnt2	A	G	11: 95,890,983	F119L	probably damaging	Het
Bcap29	T	A	12: 31,630,840	N49I	probably damaging	Het
C77080	G	T	4: 129,223,577	S476R	probably damaging	Het
Capn11	T	A	17: 45,632,401	K616*	probably null	Het
Cdh12	T	A	15: 21,520,366	Y306N	probably damaging	Het
Cep350	T	A	1: 155,953,214	N315Y	probably damaging	Het
Cited2	C	A	10: 17,724,046	P34Q	probably damaging	Het
Cmya5	A	T	13: 93,089,789	D2930E	probably benign	Het
Cog3	T	A	14: 75,729,321	K470*	probably null	Het
Commd10	A	G	18: 46,990,485	T136A	probably benign	Het
Csf2ra	C	A	19: 61,226,344	D181Y	probably damaging	Het
Csmd1	T	A	8: 15,932,610	I2686F	probably damaging	Het
Dhx29	T	C	13: 112,945,086	S415P	probably benign	Het
Dsel	A	T	1: 111,860,915	F630Y	probably damaging	Het
Ell	T	A	8: 70,578,940	I96N	possibly damaging	Het
Ephx2	T	A	14: 66,088,303	I358L	probably benign	Het
Fam162b	A	G	10: 51,587,211	I120T	probably damaging	Het
Fam187a	T	C	11: 102,885,780	Y137H	probably damaging	Het
Fastk	T	C	5: 24,441,803	E403G	probably damaging	Het
Fcrlb	C	A	1: 170,907,332	V409F	probably benign	Het
Flot2	G	T	11: 78,058,005	A269S	probably benign	Het
Gpd2	T	A	2: 57,355,551	N419K	probably damaging	Het
Hecw1	A	T	13: 14,377,765	M61K	probably null	Het
Htr2a	T	C	14: 74,706,128	F383L	probably damaging	Het
Kctd6	C	T	14: 8,222,253	R32C	probably damaging	Het
Khdc1a	A	G	1: 21,350,965	T125A	probably benign	Het
Klhl40	T	C	9: 121,779,938	S390P	probably benign	Het
Lonp1	G	A	17: 56,614,956	T808I	probably damaging	Het
Loxhd1	A	C	18: 77,404,889	D1342A	probably damaging	Het
Lrat	T	C	3: 82,897,110	I187V	probably benign	Het
Lrif1	T	C	3: 106,735,846	*238Q	probably null	Het
Lrp2bp	T	C	8: 46,011,988	F48S	probably benign	Het
Mafg	A	G	11: 120,629,678	M32T	possibly damaging	Het
Map4	C	T	9: 110,034,955	T416I	probably benign	Het
N4bp2	T	C	5: 65,808,316	F1236S	probably damaging	Het
Nfatc3	A	G	8: 106,083,834	D414G	probably damaging	Het
Nrip2	T	G	6: 128,405,074	V50G	probably damaging	Het
Olfr1449	T	A	19: 12,934,843	I35N	probably damaging	Het
Olfr16	A	G	1: 172,956,807	N4S	probably benign	Het
Olfr432	A	T	1: 174,050,799	K142I	probably benign	Het
Olfr608	T	A	7: 103,470,146	F36I	possibly damaging	Het
Pcdhb18	A	T	18: 37,490,769	H384L	probably benign	Het
Pik3r1	A	T	13: 101,686,374	Y607N	probably damaging	Het
Plagl2	G	A	2: 153,232,477	T168I	probably damaging	Het
Ppp1r16b	A	G	2: 158,761,495	K447E	possibly damaging	Het
Prkd1	T	C	12: 50,342,039	E907G	possibly damaging	Het
Rabep2	A	G	7: 126,444,540	R470G	probably damaging	Het
Rasal2	T	C	1: 157,174,160	Y518C	probably damaging	Het
Rbmxl1	A	G	8: 78,506,082	Y211H	probably damaging	Het
Rdh7	T	C	10: 127,884,585	Y306C	probably benign	Het
Rtn3	T	C	19: 7,457,911	I220V	probably damaging	Het
Scn8a	A	G	15: 101,015,861	N1045D	possibly damaging	Het
Scube1	T	C	15: 83,607,437	H952R	probably damaging	Het
Sf3b1	A	G	1: 55,000,652	I690T	probably damaging	Het
Sharpin	T	C	15: 76,347,936	K240R	probably benign	Het
Skint5	A	G	4: 113,563,459	I1108T	unknown	Het
Snip1	A	G	4: 125,071,201	D133G	probably benign	Het
St3gal3	T	C	4: 118,014,774	Y77C	probably damaging	Het
Sytl3	T	C	17: 6,715,481	V112A	probably benign	Het
Tnxb	C	T	17: 34,717,970	P3718S	probably damaging	Het
Ttc24	A	T	3: 88,073,094		probably null	Het
Ubr3	A	T	2: 70,009,129	E1529V	probably damaging	Het
Utrn	T	A	10: 12,710,138	H965L	probably benign	Het
Xrn2	T	A	2: 147,061,423	L781Q	probably damaging	Het
Zbtb11	T	C	16: 55,990,682	I401T	probably benign	Het
Zc3h14	C	T	12: 98,758,580	P167L	probably damaging	Het
Zfp609	G	T	9: 65,703,092	S863*	probably null	Het

Other mutations in Polr2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00987:Polr2a	APN	11	69743794	splice site	probably benign
IGL01067:Polr2a	APN	11	69748014	missense	possibly damaging	0.94
IGL01547:Polr2a	APN	11	69744942	missense	probably damaging	0.99
IGL01589:Polr2a	APN	11	69741194	missense	probably benign
IGL01955:Polr2a	APN	11	69741848	missense	probably damaging	1.00
IGL02457:Polr2a	APN	11	69743250	splice site	probably benign
IGL02526:Polr2a	APN	11	69739467	missense	probably benign	0.03
IGL02792:Polr2a	APN	11	69746112	missense	probably damaging	0.99
IGL03058:Polr2a	APN	11	69745047	splice site	probably null
IGL03083:Polr2a	APN	11	69745046	critical splice acceptor site	probably null
IGL03198:Polr2a	APN	11	69747281	splice site	probably null
IGL03201:Polr2a	APN	11	69745690	nonsense	probably null
Leastest	UTSW	11	69747292	splice site	probably null
PIT4260001:Polr2a	UTSW	11	69735967	missense	possibly damaging	0.93
R0126:Polr2a	UTSW	11	69747425	missense	probably damaging	0.99
R0254:Polr2a	UTSW	11	69743671	missense	possibly damaging	0.75
R0313:Polr2a	UTSW	11	69735080	missense	unknown
R0336:Polr2a	UTSW	11	69736893	missense	possibly damaging	0.92
R0453:Polr2a	UTSW	11	69741019	missense	possibly damaging	0.65
R0762:Polr2a	UTSW	11	69735117	missense	unknown
R1101:Polr2a	UTSW	11	69748071	missense	probably benign	0.23
R1509:Polr2a	UTSW	11	69747213	missense	possibly damaging	0.93
R1547:Polr2a	UTSW	11	69734555	missense	probably benign	0.39
R1567:Polr2a	UTSW	11	69746031	missense	probably benign	0.07
R1597:Polr2a	UTSW	11	69739929	missense	possibly damaging	0.88
R1614:Polr2a	UTSW	11	69743373	missense	possibly damaging	0.75
R1698:Polr2a	UTSW	11	69739877	critical splice donor site	probably null
R1743:Polr2a	UTSW	11	69739503	missense	probably damaging	0.96
R1899:Polr2a	UTSW	11	69743946	missense	probably damaging	0.99
R1900:Polr2a	UTSW	11	69743946	missense	probably damaging	0.99
R1931:Polr2a	UTSW	11	69735375	missense	unknown
R2217:Polr2a	UTSW	11	69742685	critical splice donor site	probably null
R2218:Polr2a	UTSW	11	69742685	critical splice donor site	probably null
R2245:Polr2a	UTSW	11	69735183	missense	unknown
R3123:Polr2a	UTSW	11	69735710	missense	possibly damaging	0.92
R3124:Polr2a	UTSW	11	69735710	missense	possibly damaging	0.92
R4018:Polr2a	UTSW	11	69735059	missense	unknown
R4025:Polr2a	UTSW	11	69743659	missense	possibly damaging	0.95
R4197:Polr2a	UTSW	11	69735336	missense	unknown
R4462:Polr2a	UTSW	11	69746403	missense	probably damaging	1.00
R4508:Polr2a	UTSW	11	69742559	critical splice acceptor site	probably null
R4746:Polr2a	UTSW	11	69735674	missense	probably benign	0.05
R5069:Polr2a	UTSW	11	69736735	splice site	probably null
R5102:Polr2a	UTSW	11	69746945	missense	possibly damaging	0.93
R5195:Polr2a	UTSW	11	69744079	missense	probably damaging	1.00
R5234:Polr2a	UTSW	11	69736840	missense	probably benign	0.03
R5330:Polr2a	UTSW	11	69747275	missense	probably benign	0.01
R5331:Polr2a	UTSW	11	69747275	missense	probably benign	0.01
R5896:Polr2a	UTSW	11	69736260	missense	probably damaging	0.99
R5910:Polr2a	UTSW	11	69746870	missense	probably damaging	0.99
R6128:Polr2a	UTSW	11	69736977	missense	probably damaging	1.00
R6238:Polr2a	UTSW	11	69747221	missense	possibly damaging	0.95
R6244:Polr2a	UTSW	11	69744226	missense	probably damaging	1.00
R6303:Polr2a	UTSW	11	69746913	missense	probably damaging	1.00
R6338:Polr2a	UTSW	11	69739679	splice site	probably null
R6361:Polr2a	UTSW	11	69743337	missense	probably damaging	0.99
R6374:Polr2a	UTSW	11	69736932	missense	probably damaging	0.98
R6630:Polr2a	UTSW	11	69735513	missense	possibly damaging	0.93
R6631:Polr2a	UTSW	11	69735513	missense	possibly damaging	0.93
R6633:Polr2a	UTSW	11	69735513	missense	possibly damaging	0.93
R6897:Polr2a	UTSW	11	69735961	missense	probably benign	0.12
R6923:Polr2a	UTSW	11	69735961	missense	probably benign	0.12
R6933:Polr2a	UTSW	11	69736177	missense	probably damaging	0.99
R6933:Polr2a	UTSW	11	69739467	missense	probably benign	0.03
R6953:Polr2a	UTSW	11	69741711	missense	probably damaging	0.99
R6974:Polr2a	UTSW	11	69747200	missense	probably damaging	0.98
R7033:Polr2a	UTSW	11	69747213	missense	possibly damaging	0.93
R7085:Polr2a	UTSW	11	69743880	missense	probably damaging	0.99
R7112:Polr2a	UTSW	11	69735309	missense	unknown
R7124:Polr2a	UTSW	11	69737462	nonsense	probably null
R7307:Polr2a	UTSW	11	69747292	splice site	probably null
R7319:Polr2a	UTSW	11	69746370	missense	possibly damaging	0.95
R7350:Polr2a	UTSW	11	69741060	missense	possibly damaging	0.92
R7369:Polr2a	UTSW	11	69745977	missense	probably benign	0.01
R7585:Polr2a	UTSW	11	69740002	missense	probably damaging	0.99
R7882:Polr2a	UTSW	11	69736174	missense	possibly damaging	0.86
R7935:Polr2a	UTSW	11	69747504	missense	probably benign	0.00
R8080:Polr2a	UTSW	11	69735048	missense	unknown
R8140:Polr2a	UTSW	11	69746376	missense	probably benign	0.12
R8221:Polr2a	UTSW	11	69737518	missense	probably benign	0.24
R8245:Polr2a	UTSW	11	69739953	missense	probably damaging	0.99
R8274:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8275:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8276:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8277:Polr2a	UTSW	11	69748056	missense	probably damaging	0.99
R8311:Polr2a	UTSW	11	69737456	missense	probably null	0.20
R8477:Polr2a	UTSW	11	69735486	missense	probably benign	0.00
R8677:Polr2a	UTSW	11	69735555	missense	possibly damaging	0.85
R8976:Polr2a	UTSW	11	69747211	missense	possibly damaging	0.92
R9296:Polr2a	UTSW	11	69734736	missense	probably benign	0.39
R9659:Polr2a	UTSW	11	69734828	missense	unknown
R9731:Polr2a	UTSW	11	69747217	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- ACCACTAGGAACAGGACGGCTAATG -3'
(R):5'- TAAGACTGCTGAGACTGGTGAGGC -3'

Sequencing Primer
(F):5'- TAGGGAGACTTCAAATCTGCCTC -3'
(R):5'- CCATCTAAAGGTGAATTTTGGTCTC -3'

Posted On

2014-05-23