Mutagenetix > Incidental Mutations

Incidental Mutation 'R1735:Hecw1'

199663

Institutional Source

Beutler Lab

Gene Symbol

Hecw1

Ensembl Gene

ENSMUSG00000021301

Gene Name

HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1

Synonyms

E130207I19Rik, NEDL1

MMRRC Submission

039767-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1735 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

14226438-14523228 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 14377765 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 61 (M61K)

Ref Sequence

ENSEMBL: ENSMUSP00000152351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110516] [ENSMUST00000221274] [ENSMUST00000223189] [ENSMUST00000223550]

AlphaFold

Q8K4P8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000110516
AA Change: M82K

PolyPhen 2 Score 0.673 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: M82K

Domain	Start	End	E-Value	Type
Pfam:HECW_N	65	184	6.5e-62	PFAM
C2	206	317	1.02e-12	SMART
low complexity region	463	477	N/A	INTRINSIC
low complexity region	497	512	N/A	INTRINSIC
low complexity region	577	598	N/A	INTRINSIC
low complexity region	677	704	N/A	INTRINSIC
low complexity region	731	745	N/A	INTRINSIC
WW	827	859	8.66e-13	SMART
coiled coil region	873	898	N/A	INTRINSIC
low complexity region	917	930	N/A	INTRINSIC
WW	1017	1049	5.59e-7	SMART
Blast:HECTc	1137	1192	3e-26	BLAST
low complexity region	1193	1208	N/A	INTRINSIC
low complexity region	1212	1223	N/A	INTRINSIC
HECTc	1267	1604	1.36e-185	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000221274
AA Change: M61K

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000221863

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222578

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222904

Predicted Effect

probably benign
Transcript: ENSMUST00000223189
AA Change: M83K

PolyPhen 2 Score 0.178 (Sensitivity: 0.92; Specificity: 0.87)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223317

Predicted Effect

probably null
Transcript: ENSMUST00000223550

Coding Region Coverage

1x: 97.6%
3x: 97.0%
10x: 95.3%
20x: 92.1%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	A	C	9: 8,027,265	S91A	probably benign	Het
Acot5	A	T	12: 84,075,487	I282F	probably benign	Het
Adam19	C	A	11: 46,138,917	Q730K	probably benign	Het
Adgrv1	A	G	13: 81,487,947	V3481A	possibly damaging	Het
Akr1c20	T	C	13: 4,487,208	D316G	probably benign	Het
Ap3b1	G	A	13: 94,493,717	V827I	unknown	Het
Aph1a	T	A	3: 95,895,509	D140E	probably damaging	Het
Arhgef19	G	T	4: 141,249,618	V502L	possibly damaging	Het
Arl9	T	C	5: 77,006,626	F67S	probably damaging	Het
B430305J03Rik	G	A	3: 61,363,940		probably benign	Het
B4galnt2	A	G	11: 95,890,983	F119L	probably damaging	Het
Bcap29	T	A	12: 31,630,840	N49I	probably damaging	Het
C77080	G	T	4: 129,223,577	S476R	probably damaging	Het
Capn11	T	A	17: 45,632,401	K616*	probably null	Het
Cdh12	T	A	15: 21,520,366	Y306N	probably damaging	Het
Cep350	T	A	1: 155,953,214	N315Y	probably damaging	Het
Cited2	C	A	10: 17,724,046	P34Q	probably damaging	Het
Cmya5	A	T	13: 93,089,789	D2930E	probably benign	Het
Cog3	T	A	14: 75,729,321	K470*	probably null	Het
Commd10	A	G	18: 46,990,485	T136A	probably benign	Het
Csf2ra	C	A	19: 61,226,344	D181Y	probably damaging	Het
Csmd1	T	A	8: 15,932,610	I2686F	probably damaging	Het
Dhx29	T	C	13: 112,945,086	S415P	probably benign	Het
Dsel	A	T	1: 111,860,915	F630Y	probably damaging	Het
Ell	T	A	8: 70,578,940	I96N	possibly damaging	Het
Ephx2	T	A	14: 66,088,303	I358L	probably benign	Het
Fam162b	A	G	10: 51,587,211	I120T	probably damaging	Het
Fam187a	T	C	11: 102,885,780	Y137H	probably damaging	Het
Fastk	T	C	5: 24,441,803	E403G	probably damaging	Het
Fcrlb	C	A	1: 170,907,332	V409F	probably benign	Het
Flot2	G	T	11: 78,058,005	A269S	probably benign	Het
Gpd2	T	A	2: 57,355,551	N419K	probably damaging	Het
Htr2a	T	C	14: 74,706,128	F383L	probably damaging	Het
Kctd6	C	T	14: 8,222,253	R32C	probably damaging	Het
Khdc1a	A	G	1: 21,350,965	T125A	probably benign	Het
Klhl40	T	C	9: 121,779,938	S390P	probably benign	Het
Lonp1	G	A	17: 56,614,956	T808I	probably damaging	Het
Loxhd1	A	C	18: 77,404,889	D1342A	probably damaging	Het
Lrat	T	C	3: 82,897,110	I187V	probably benign	Het
Lrif1	T	C	3: 106,735,846	*238Q	probably null	Het
Lrp2bp	T	C	8: 46,011,988	F48S	probably benign	Het
Mafg	A	G	11: 120,629,678	M32T	possibly damaging	Het
Map4	C	T	9: 110,034,955	T416I	probably benign	Het
N4bp2	T	C	5: 65,808,316	F1236S	probably damaging	Het
Nfatc3	A	G	8: 106,083,834	D414G	probably damaging	Het
Nrip2	T	G	6: 128,405,074	V50G	probably damaging	Het
Olfr1449	T	A	19: 12,934,843	I35N	probably damaging	Het
Olfr16	A	G	1: 172,956,807	N4S	probably benign	Het
Olfr432	A	T	1: 174,050,799	K142I	probably benign	Het
Olfr608	T	A	7: 103,470,146	F36I	possibly damaging	Het
Pcdhb18	A	T	18: 37,490,769	H384L	probably benign	Het
Pik3r1	A	T	13: 101,686,374	Y607N	probably damaging	Het
Plagl2	G	A	2: 153,232,477	T168I	probably damaging	Het
Polr2a	A	G	11: 69,742,396	S912P	probably damaging	Het
Ppp1r16b	A	G	2: 158,761,495	K447E	possibly damaging	Het
Prkd1	T	C	12: 50,342,039	E907G	possibly damaging	Het
Rabep2	A	G	7: 126,444,540	R470G	probably damaging	Het
Rasal2	T	C	1: 157,174,160	Y518C	probably damaging	Het
Rbmxl1	A	G	8: 78,506,082	Y211H	probably damaging	Het
Rdh7	T	C	10: 127,884,585	Y306C	probably benign	Het
Rtn3	T	C	19: 7,457,911	I220V	probably damaging	Het
Scn8a	A	G	15: 101,015,861	N1045D	possibly damaging	Het
Scube1	T	C	15: 83,607,437	H952R	probably damaging	Het
Sf3b1	A	G	1: 55,000,652	I690T	probably damaging	Het
Sharpin	T	C	15: 76,347,936	K240R	probably benign	Het
Skint5	A	G	4: 113,563,459	I1108T	unknown	Het
Snip1	A	G	4: 125,071,201	D133G	probably benign	Het
St3gal3	T	C	4: 118,014,774	Y77C	probably damaging	Het
Sytl3	T	C	17: 6,715,481	V112A	probably benign	Het
Tnxb	C	T	17: 34,717,970	P3718S	probably damaging	Het
Ttc24	A	T	3: 88,073,094		probably null	Het
Ubr3	A	T	2: 70,009,129	E1529V	probably damaging	Het
Utrn	T	A	10: 12,710,138	H965L	probably benign	Het
Xrn2	T	A	2: 147,061,423	L781Q	probably damaging	Het
Zbtb11	T	C	16: 55,990,682	I401T	probably benign	Het
Zc3h14	C	T	12: 98,758,580	P167L	probably damaging	Het
Zfp609	G	T	9: 65,703,092	S863*	probably null	Het

Other mutations in Hecw1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00591:Hecw1	APN	13	14265980	missense	possibly damaging	0.71
IGL00813:Hecw1	APN	13	14278376	critical splice acceptor site	probably null
IGL00843:Hecw1	APN	13	14247573	missense	probably benign	0.02
IGL00942:Hecw1	APN	13	14340740	splice site	probably benign
IGL00976:Hecw1	APN	13	14318972	missense	probably damaging	1.00
IGL01289:Hecw1	APN	13	14264134	missense	probably damaging	1.00
IGL01675:Hecw1	APN	13	14234422	missense	probably damaging	1.00
IGL01783:Hecw1	APN	13	14278293	missense	probably damaging	1.00
IGL01941:Hecw1	APN	13	14316310	missense	probably benign	0.01
IGL02170:Hecw1	APN	13	14264158	missense	possibly damaging	0.75
IGL02172:Hecw1	APN	13	14264149	missense	probably damaging	1.00
IGL02214:Hecw1	APN	13	14300393	missense	probably damaging	1.00
IGL02350:Hecw1	APN	13	14248338	splice site	probably null
IGL02357:Hecw1	APN	13	14248338	splice site	probably null
IGL02372:Hecw1	APN	13	14264121	missense	probably damaging	1.00
IGL02591:Hecw1	APN	13	14357236	splice site	probably benign
IGL02718:Hecw1	APN	13	14306935	critical splice acceptor site	probably null
IGL02795:Hecw1	APN	13	14322517	missense	probably damaging	1.00
IGL02941:Hecw1	APN	13	14377726	missense	probably damaging	1.00
IGL03256:Hecw1	APN	13	14280484	missense	probably damaging	0.99
IGL03256:Hecw1	APN	13	14280485	missense	probably benign	0.36
IGL03366:Hecw1	APN	13	14377797	missense	probably damaging	1.00
deflated	UTSW	13	14247620	missense	possibly damaging	0.69
Demoralized	UTSW	13	14316818	nonsense	probably null
Letdown	UTSW	13	14316492	missense	probably benign	0.40
BB001:Hecw1	UTSW	13	14322528	missense	probably damaging	1.00
BB011:Hecw1	UTSW	13	14322528	missense	probably damaging	1.00
IGL03014:Hecw1	UTSW	13	14245808	missense	probably damaging	1.00
PIT4378001:Hecw1	UTSW	13	14377783	missense	probably damaging	0.98
R0555:Hecw1	UTSW	13	14236941	missense	probably damaging	1.00
R0617:Hecw1	UTSW	13	14280442	missense	probably benign	0.44
R1476:Hecw1	UTSW	13	14306086	missense	probably damaging	1.00
R1479:Hecw1	UTSW	13	14316492	missense	probably benign	0.40
R1551:Hecw1	UTSW	13	14316943	missense	probably damaging	1.00
R1579:Hecw1	UTSW	13	14377907	missense	probably damaging	1.00
R1584:Hecw1	UTSW	13	14340743	critical splice donor site	probably null
R1872:Hecw1	UTSW	13	14280449	nonsense	probably null
R1897:Hecw1	UTSW	13	14377940	missense	probably damaging	1.00
R2054:Hecw1	UTSW	13	14297413	missense	probably damaging	0.97
R2085:Hecw1	UTSW	13	14264087	missense	possibly damaging	0.93
R2134:Hecw1	UTSW	13	14377700	missense	probably damaging	1.00
R2172:Hecw1	UTSW	13	14377706	missense	probably damaging	1.00
R2258:Hecw1	UTSW	13	14316138	missense	probably benign	0.01
R2274:Hecw1	UTSW	13	14346068	missense	probably benign	0.00
R2275:Hecw1	UTSW	13	14346068	missense	probably benign	0.00
R2937:Hecw1	UTSW	13	14245836	missense	possibly damaging	0.93
R3830:Hecw1	UTSW	13	14346058	missense	probably benign	0.13
R3971:Hecw1	UTSW	13	14236929	missense	probably damaging	1.00
R4065:Hecw1	UTSW	13	14316431	missense	probably damaging	1.00
R4066:Hecw1	UTSW	13	14316431	missense	probably damaging	1.00
R4235:Hecw1	UTSW	13	14317139	missense	probably benign	0.42
R4366:Hecw1	UTSW	13	14316164	missense	probably damaging	1.00
R4382:Hecw1	UTSW	13	14316164	missense	probably damaging	1.00
R4385:Hecw1	UTSW	13	14316164	missense	probably damaging	1.00
R4510:Hecw1	UTSW	13	14357191	missense	probably damaging	1.00
R4511:Hecw1	UTSW	13	14357191	missense	probably damaging	1.00
R4558:Hecw1	UTSW	13	14247605	missense	probably damaging	0.99
R4804:Hecw1	UTSW	13	14305985	missense	probably benign	0.00
R4854:Hecw1	UTSW	13	14316892	missense	probably benign	0.00
R5104:Hecw1	UTSW	13	14340792	missense	probably damaging	1.00
R5113:Hecw1	UTSW	13	14346029	missense	possibly damaging	0.94
R5167:Hecw1	UTSW	13	14285657	missense	probably damaging	1.00
R5392:Hecw1	UTSW	13	14245762	missense	probably damaging	1.00
R5394:Hecw1	UTSW	13	14322589	missense	probably damaging	1.00
R5504:Hecw1	UTSW	13	14340902	missense	probably benign	0.04
R5764:Hecw1	UTSW	13	14322509	missense	probably damaging	1.00
R6038:Hecw1	UTSW	13	14346062	missense	probably benign	0.28
R6038:Hecw1	UTSW	13	14346062	missense	probably benign	0.28
R6228:Hecw1	UTSW	13	14346038	missense	probably damaging	1.00
R6247:Hecw1	UTSW	13	14234425	nonsense	probably null
R6252:Hecw1	UTSW	13	14272079	missense	probably damaging	0.98
R6291:Hecw1	UTSW	13	14523007	unclassified	probably benign
R6321:Hecw1	UTSW	13	14522829	missense	probably benign	0.00
R6325:Hecw1	UTSW	13	14316446	missense	probably damaging	1.00
R6328:Hecw1	UTSW	13	14247620	missense	possibly damaging	0.69
R6557:Hecw1	UTSW	13	14316646	missense	possibly damaging	0.78
R6566:Hecw1	UTSW	13	14297283	missense	probably damaging	1.00
R6597:Hecw1	UTSW	13	14316818	nonsense	probably null
R6821:Hecw1	UTSW	13	14264134	missense	probably damaging	1.00
R6914:Hecw1	UTSW	13	14316838	missense	probably damaging	0.99
R7078:Hecw1	UTSW	13	14434459	start codon destroyed	probably null	0.21
R7114:Hecw1	UTSW	13	14311771	missense	probably benign	0.02
R7140:Hecw1	UTSW	13	14316533	missense	probably benign
R7150:Hecw1	UTSW	13	14434460	start codon destroyed	probably benign
R7288:Hecw1	UTSW	13	14316236	missense	probably benign	0.00
R7447:Hecw1	UTSW	13	14357204	missense	probably damaging	1.00
R7479:Hecw1	UTSW	13	14340840	missense	probably damaging	1.00
R7552:Hecw1	UTSW	13	14316250	missense	probably damaging	0.99
R7590:Hecw1	UTSW	13	14264083	missense	probably damaging	1.00
R7787:Hecw1	UTSW	13	14318909	missense	probably damaging	1.00
R7803:Hecw1	UTSW	13	14234342	missense	probably benign	0.25
R7924:Hecw1	UTSW	13	14322528	missense	probably damaging	1.00
R7967:Hecw1	UTSW	13	14377747	missense	probably damaging	1.00
R8176:Hecw1	UTSW	13	14247701	splice site	probably null
R8195:Hecw1	UTSW	13	14306107	missense	probably damaging	0.99
R8252:Hecw1	UTSW	13	14340840	missense	probably damaging	1.00
R8696:Hecw1	UTSW	13	14357158	missense	possibly damaging	0.93
R8827:Hecw1	UTSW	13	14264135	missense	probably damaging	1.00
R8867:Hecw1	UTSW	13	14247690	critical splice acceptor site	probably null
R8914:Hecw1	UTSW	13	14247603	missense	probably damaging	1.00
R8942:Hecw1	UTSW	13	14306810	missense	probably benign	0.28
R9126:Hecw1	UTSW	13	14372023	missense	probably damaging	1.00
R9185:Hecw1	UTSW	13	14317043	missense	probably damaging	0.99
R9203:Hecw1	UTSW	13	14316658	missense	probably benign	0.00
R9236:Hecw1	UTSW	13	14316058	missense	possibly damaging	0.61
R9291:Hecw1	UTSW	13	14316937	missense	probably benign
R9312:Hecw1	UTSW	13	14371982	missense	probably damaging	0.99
R9438:Hecw1	UTSW	13	14306829	missense	probably benign	0.00
RF001:Hecw1	UTSW	13	14297424	missense	probably damaging	1.00
X0020:Hecw1	UTSW	13	14230723	missense	possibly damaging	0.52
X0066:Hecw1	UTSW	13	14280460	missense	probably benign	0.13
Z1176:Hecw1	UTSW	13	14300333	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- TTCACAGCACACCGTCAGACTATTC -3'
(R):5'- GTTTCACATCTCTCTGAAGGGCAGC -3'

Sequencing Primer
(F):5'- CCGTCAGACTATTCAGATGAATCAG -3'
(R):5'- CTGTACCAGAACAGGTTTTTAGGC -3'

Posted On

2014-05-23