Mutagenetix > Incidental Mutations

Incidental Mutation 'R1735:Loxhd1'

199687

Institutional Source

Beutler Lab

Gene Symbol

Loxhd1

Ensembl Gene

ENSMUSG00000032818

Gene Name

lipoxygenase homology domains 1

Synonyms

sba, 1700096C21Rik

MMRRC Submission

039767-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R1735 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77281958-77442341 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 77404889 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 1342 (D1342A)

Ref Sequence

ENSEMBL: ENSMUSP00000114988 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123166] [ENSMUST00000123410] [ENSMUST00000148341]

AlphaFold

C8YR32

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096547
AA Change: D1451A

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: D1451A

Domain	Start	End	E-Value	Type
LH2	43	158	5.64e-5	SMART
LH2	172	290	1.64e-9	SMART
LH2	296	409	1.1e-4	SMART
LH2	425	539	4.02e-4	SMART
LH2	553	675	3.79e-6	SMART
LH2	684	800	5.92e-6	SMART
LH2	814	936	6.91e-8	SMART
low complexity region	945	954	N/A	INTRINSIC
LH2	970	1086	4.81e-7	SMART
LH2	1101	1228	5.73e-3	SMART
LH2	1255	1375	8.82e-5	SMART
Pfam:PLAT	1424	1540	5.4e-10	PFAM
LH2	1553	1666	6.41e-3	SMART
LH2	1680	1799	6.76e-6	SMART
Pfam:PLAT	1813	1929	3.8e-9	PFAM
LH2	1949	2067	7.23e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123166

SMART Domains

Protein: ENSMUSP00000116287
Gene: ENSMUSG00000032818

Domain	Start	End	E-Value	Type
LH2	1	114	6.41e-3	SMART
LH2	128	247	6.76e-6	SMART
Pfam:PLAT	261	379	1.3e-8	PFAM
LH2	397	515	7.23e-11	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123410
AA Change: D585A

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: D585A

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	67	4.4e-15	PFAM
low complexity region	79	88	N/A	INTRINSIC
LH2	104	220	4.81e-7	SMART
LH2	235	362	5.73e-3	SMART
LH2	389	509	8.82e-5	SMART
Pfam:PLAT	558	674	9.9e-12	PFAM
LH2	687	800	6.41e-3	SMART
LH2	814	933	6.76e-6	SMART
Pfam:PLAT	947	1065	8.8e-9	PFAM
Pfam:PLAT	1085	1174	4.2e-11	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000148341
AA Change: D1342A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: D1342A

Domain	Start	End	E-Value	Type
Pfam:PLAT	1	91	1.7e-11	PFAM
LH2	106	220	4.02e-4	SMART
LH2	234	356	3.79e-6	SMART
LH2	365	481	5.92e-6	SMART
LH2	495	610	7.67e-3	SMART
LH2	707	827	1.47e-11	SMART
low complexity region	836	845	N/A	INTRINSIC
LH2	861	977	4.81e-7	SMART
LH2	992	1119	5.73e-3	SMART
LH2	1146	1266	8.82e-5	SMART
Pfam:PLAT	1384	1469	8.9e-14	PFAM

Coding Region Coverage

1x: 97.6%
3x: 97.0%
10x: 95.3%
20x: 92.1%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	A	C	9: 8,027,265	S91A	probably benign	Het
Acot5	A	T	12: 84,075,487	I282F	probably benign	Het
Adam19	C	A	11: 46,138,917	Q730K	probably benign	Het
Adgrv1	A	G	13: 81,487,947	V3481A	possibly damaging	Het
Akr1c20	T	C	13: 4,487,208	D316G	probably benign	Het
Ap3b1	G	A	13: 94,493,717	V827I	unknown	Het
Aph1a	T	A	3: 95,895,509	D140E	probably damaging	Het
Arhgef19	G	T	4: 141,249,618	V502L	possibly damaging	Het
Arl9	T	C	5: 77,006,626	F67S	probably damaging	Het
B430305J03Rik	G	A	3: 61,363,940		probably benign	Het
B4galnt2	A	G	11: 95,890,983	F119L	probably damaging	Het
Bcap29	T	A	12: 31,630,840	N49I	probably damaging	Het
C77080	G	T	4: 129,223,577	S476R	probably damaging	Het
Capn11	T	A	17: 45,632,401	K616*	probably null	Het
Cdh12	T	A	15: 21,520,366	Y306N	probably damaging	Het
Cep350	T	A	1: 155,953,214	N315Y	probably damaging	Het
Cited2	C	A	10: 17,724,046	P34Q	probably damaging	Het
Cmya5	A	T	13: 93,089,789	D2930E	probably benign	Het
Cog3	T	A	14: 75,729,321	K470*	probably null	Het
Commd10	A	G	18: 46,990,485	T136A	probably benign	Het
Csf2ra	C	A	19: 61,226,344	D181Y	probably damaging	Het
Csmd1	T	A	8: 15,932,610	I2686F	probably damaging	Het
Dhx29	T	C	13: 112,945,086	S415P	probably benign	Het
Dsel	A	T	1: 111,860,915	F630Y	probably damaging	Het
Ell	T	A	8: 70,578,940	I96N	possibly damaging	Het
Ephx2	T	A	14: 66,088,303	I358L	probably benign	Het
Fam162b	A	G	10: 51,587,211	I120T	probably damaging	Het
Fam187a	T	C	11: 102,885,780	Y137H	probably damaging	Het
Fastk	T	C	5: 24,441,803	E403G	probably damaging	Het
Fcrlb	C	A	1: 170,907,332	V409F	probably benign	Het
Flot2	G	T	11: 78,058,005	A269S	probably benign	Het
Gpd2	T	A	2: 57,355,551	N419K	probably damaging	Het
Hecw1	A	T	13: 14,377,765	M61K	probably null	Het
Htr2a	T	C	14: 74,706,128	F383L	probably damaging	Het
Kctd6	C	T	14: 8,222,253	R32C	probably damaging	Het
Khdc1a	A	G	1: 21,350,965	T125A	probably benign	Het
Klhl40	T	C	9: 121,779,938	S390P	probably benign	Het
Lonp1	G	A	17: 56,614,956	T808I	probably damaging	Het
Lrat	T	C	3: 82,897,110	I187V	probably benign	Het
Lrif1	T	C	3: 106,735,846	*238Q	probably null	Het
Lrp2bp	T	C	8: 46,011,988	F48S	probably benign	Het
Mafg	A	G	11: 120,629,678	M32T	possibly damaging	Het
Map4	C	T	9: 110,034,955	T416I	probably benign	Het
N4bp2	T	C	5: 65,808,316	F1236S	probably damaging	Het
Nfatc3	A	G	8: 106,083,834	D414G	probably damaging	Het
Nrip2	T	G	6: 128,405,074	V50G	probably damaging	Het
Olfr1449	T	A	19: 12,934,843	I35N	probably damaging	Het
Olfr16	A	G	1: 172,956,807	N4S	probably benign	Het
Olfr432	A	T	1: 174,050,799	K142I	probably benign	Het
Olfr608	T	A	7: 103,470,146	F36I	possibly damaging	Het
Pcdhb18	A	T	18: 37,490,769	H384L	probably benign	Het
Pik3r1	A	T	13: 101,686,374	Y607N	probably damaging	Het
Plagl2	G	A	2: 153,232,477	T168I	probably damaging	Het
Polr2a	A	G	11: 69,742,396	S912P	probably damaging	Het
Ppp1r16b	A	G	2: 158,761,495	K447E	possibly damaging	Het
Prkd1	T	C	12: 50,342,039	E907G	possibly damaging	Het
Rabep2	A	G	7: 126,444,540	R470G	probably damaging	Het
Rasal2	T	C	1: 157,174,160	Y518C	probably damaging	Het
Rbmxl1	A	G	8: 78,506,082	Y211H	probably damaging	Het
Rdh7	T	C	10: 127,884,585	Y306C	probably benign	Het
Rtn3	T	C	19: 7,457,911	I220V	probably damaging	Het
Scn8a	A	G	15: 101,015,861	N1045D	possibly damaging	Het
Scube1	T	C	15: 83,607,437	H952R	probably damaging	Het
Sf3b1	A	G	1: 55,000,652	I690T	probably damaging	Het
Sharpin	T	C	15: 76,347,936	K240R	probably benign	Het
Skint5	A	G	4: 113,563,459	I1108T	unknown	Het
Snip1	A	G	4: 125,071,201	D133G	probably benign	Het
St3gal3	T	C	4: 118,014,774	Y77C	probably damaging	Het
Sytl3	T	C	17: 6,715,481	V112A	probably benign	Het
Tnxb	C	T	17: 34,717,970	P3718S	probably damaging	Het
Ttc24	A	T	3: 88,073,094		probably null	Het
Ubr3	A	T	2: 70,009,129	E1529V	probably damaging	Het
Utrn	T	A	10: 12,710,138	H965L	probably benign	Het
Xrn2	T	A	2: 147,061,423	L781Q	probably damaging	Het
Zbtb11	T	C	16: 55,990,682	I401T	probably benign	Het
Zc3h14	C	T	12: 98,758,580	P167L	probably damaging	Het
Zfp609	G	T	9: 65,703,092	S863*	probably null	Het

Other mutations in Loxhd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00330:Loxhd1	APN	18	77395450	missense	probably damaging	0.99
IGL00490:Loxhd1	APN	18	77431074	missense	possibly damaging	0.94
IGL00507:Loxhd1	APN	18	77332567	missense	probably benign	0.03
IGL00546:Loxhd1	APN	18	77405976	missense	probably damaging	0.97
IGL01369:Loxhd1	APN	18	77329201	missense	possibly damaging	0.85
IGL01767:Loxhd1	APN	18	77286424	missense	possibly damaging	0.71
IGL02245:Loxhd1	APN	18	77340101	missense	possibly damaging	0.71
IGL02388:Loxhd1	APN	18	77369137	missense	probably benign	0.18
IGL02410:Loxhd1	APN	18	77402952	missense	probably benign	0.02
IGL02593:Loxhd1	APN	18	77410539	missense	possibly damaging	0.91
IGL02632:Loxhd1	APN	18	77405932	missense	probably damaging	0.99
IGL02692:Loxhd1	APN	18	77356913	missense	probably damaging	0.99
IGL02796:Loxhd1	APN	18	77369115	splice site	probably benign
IGL03032:Loxhd1	APN	18	77286473	missense	possibly damaging	0.93
IGL03074:Loxhd1	APN	18	77441784	missense	possibly damaging	0.75
IGL03094:Loxhd1	APN	18	77431113	missense	possibly damaging	0.88
IGL03118:Loxhd1	APN	18	77380464	missense	probably damaging	1.00
IGL03232:Loxhd1	APN	18	77408750	missense	probably damaging	1.00
IGL03377:Loxhd1	APN	18	77441673	missense	possibly damaging	0.91
H8562:Loxhd1	UTSW	18	77341931	missense	possibly damaging	0.93
PIT4494001:Loxhd1	UTSW	18	77441768	missense	probably damaging	0.99
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0003:Loxhd1	UTSW	18	77339500	missense	probably damaging	0.98
R0048:Loxhd1	UTSW	18	77408778	missense	probably damaging	0.99
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0049:Loxhd1	UTSW	18	77380560	splice site	probably benign
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0206:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0208:Loxhd1	UTSW	18	77404866	missense	possibly damaging	0.90
R0323:Loxhd1	UTSW	18	77369137	missense	probably benign	0.18
R0332:Loxhd1	UTSW	18	77383830	splice site	probably null
R0367:Loxhd1	UTSW	18	77425757	splice site	probably benign
R0709:Loxhd1	UTSW	18	77404969	missense	probably benign	0.23
R0783:Loxhd1	UTSW	18	77429984	missense	possibly damaging	0.58
R1132:Loxhd1	UTSW	18	77429943	missense	possibly damaging	0.71
R1232:Loxhd1	UTSW	18	77406003	critical splice donor site	probably null
R1331:Loxhd1	UTSW	18	77402936	missense	possibly damaging	0.86
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1465:Loxhd1	UTSW	18	77380573	splice site	probably null
R1501:Loxhd1	UTSW	18	77356832	missense	probably damaging	1.00
R1640:Loxhd1	UTSW	18	77402563	missense	probably damaging	1.00
R1656:Loxhd1	UTSW	18	77321668	missense	possibly damaging	0.71
R1671:Loxhd1	UTSW	18	77404802	missense	probably damaging	1.00
R1725:Loxhd1	UTSW	18	77293241	missense	probably benign	0.32
R1796:Loxhd1	UTSW	18	77405907	missense	probably damaging	0.96
R1796:Loxhd1	UTSW	18	77425639	missense	possibly damaging	0.88
R1800:Loxhd1	UTSW	18	77402502	missense	probably damaging	1.00
R1848:Loxhd1	UTSW	18	77281971	missense	possibly damaging	0.53
R1912:Loxhd1	UTSW	18	77340137	missense	probably benign	0.32
R1945:Loxhd1	UTSW	18	77404808	missense	probably damaging	1.00
R1978:Loxhd1	UTSW	18	77321642	missense	possibly damaging	0.86
R1997:Loxhd1	UTSW	18	77295769	missense	probably damaging	0.98
R2086:Loxhd1	UTSW	18	77384946	missense	probably damaging	1.00
R2153:Loxhd1	UTSW	18	77356166	missense	possibly damaging	0.72
R3124:Loxhd1	UTSW	18	77431078	missense	probably damaging	0.97
R3896:Loxhd1	UTSW	18	77382023	missense	possibly damaging	0.65
R3907:Loxhd1	UTSW	18	77408768	missense	possibly damaging	0.60
R3980:Loxhd1	UTSW	18	77414159	missense	probably damaging	1.00
R4165:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4166:Loxhd1	UTSW	18	77372329	missense	probably damaging	0.99
R4176:Loxhd1	UTSW	18	77331059	missense	possibly damaging	0.53
R4345:Loxhd1	UTSW	18	77399001	missense	possibly damaging	0.89
R4354:Loxhd1	UTSW	18	77395427	missense	probably damaging	1.00
R4385:Loxhd1	UTSW	18	77372911	missense	probably damaging	0.99
R4402:Loxhd1	UTSW	18	77441760	missense	possibly damaging	0.94
R4404:Loxhd1	UTSW	18	77431132	missense	probably damaging	1.00
R4456:Loxhd1	UTSW	18	77399089	missense	probably damaging	1.00
R4525:Loxhd1	UTSW	18	77356912	missense	probably damaging	0.98
R4605:Loxhd1	UTSW	18	77405946	missense	probably benign	0.00
R4661:Loxhd1	UTSW	18	77402885	missense	possibly damaging	0.79
R4698:Loxhd1	UTSW	18	77372291	missense	possibly damaging	0.82
R4725:Loxhd1	UTSW	18	77395457	missense	probably damaging	1.00
R4820:Loxhd1	UTSW	18	77384967	missense	probably damaging	1.00
R5163:Loxhd1	UTSW	18	77361736	missense	possibly damaging	0.92
R5288:Loxhd1	UTSW	18	77363612	missense	probably damaging	1.00
R5328:Loxhd1	UTSW	18	77410572	missense	probably damaging	1.00
R5329:Loxhd1	UTSW	18	77332682	missense	probably damaging	0.98
R5347:Loxhd1	UTSW	18	77366541	missense	probably damaging	1.00
R5589:Loxhd1	UTSW	18	77342055	missense	possibly damaging	0.86
R5616:Loxhd1	UTSW	18	77404951	missense	probably damaging	1.00
R5703:Loxhd1	UTSW	18	77356877	missense	probably damaging	1.00
R5837:Loxhd1	UTSW	18	77286409	missense	possibly damaging	0.71
R5888:Loxhd1	UTSW	18	77402515	missense	probably damaging	0.99
R6021:Loxhd1	UTSW	18	77412250	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6032:Loxhd1	UTSW	18	77381558	missense	probably damaging	1.00
R6153:Loxhd1	UTSW	18	77295758	missense	possibly damaging	0.71
R6174:Loxhd1	UTSW	18	77412178	missense	probably damaging	1.00
R6265:Loxhd1	UTSW	18	77361730	missense	probably damaging	0.99
R6377:Loxhd1	UTSW	18	77380432	missense	probably damaging	1.00
R6530:Loxhd1	UTSW	18	77412151	missense	probably benign	0.30
R6555:Loxhd1	UTSW	18	77293269	missense	possibly damaging	0.51
R6782:Loxhd1	UTSW	18	77431177	missense	probably damaging	0.99
R6834:Loxhd1	UTSW	18	77441526	missense	probably damaging	1.00
R7000:Loxhd1	UTSW	18	77372433	critical splice donor site	probably null
R7112:Loxhd1	UTSW	18	77388514	missense	probably damaging	1.00
R7203:Loxhd1	UTSW	18	77414196	missense	probably damaging	0.97
R7206:Loxhd1	UTSW	18	77441817	missense	probably damaging	0.97
R7260:Loxhd1	UTSW	18	77332642	missense	possibly damaging	0.93
R7432:Loxhd1	UTSW	18	77295851	missense	possibly damaging	0.51
R7475:Loxhd1	UTSW	18	77412305	missense	possibly damaging	0.83
R7555:Loxhd1	UTSW	18	77395365	missense	probably damaging	0.99
R7590:Loxhd1	UTSW	18	77321634	missense	possibly damaging	0.84
R7612:Loxhd1	UTSW	18	77429975	missense	possibly damaging	0.95
R7626:Loxhd1	UTSW	18	77431186	missense	possibly damaging	0.75
R7768:Loxhd1	UTSW	18	77384941	missense	probably damaging	0.99
R7791:Loxhd1	UTSW	18	77383729	missense	probably damaging	1.00
R7829:Loxhd1	UTSW	18	77408787	missense	probably damaging	0.99
R7884:Loxhd1	UTSW	18	77431213	missense	probably damaging	0.98
R7960:Loxhd1	UTSW	18	77385050	missense	probably damaging	0.99
R7986:Loxhd1	UTSW	18	77375194	missense	possibly damaging	0.88
R8042:Loxhd1	UTSW	18	77431192	missense	probably damaging	0.99
R8084:Loxhd1	UTSW	18	77340149	missense	possibly damaging	0.71
R8088:Loxhd1	UTSW	18	77342013	missense	possibly damaging	0.52
R8100:Loxhd1	UTSW	18	77404816	missense	possibly damaging	0.69
R8139:Loxhd1	UTSW	18	77380496	missense	possibly damaging	0.95
R8152:Loxhd1	UTSW	18	77388399	missense	possibly damaging	0.62
R8199:Loxhd1	UTSW	18	77381638	missense	possibly damaging	0.77
R8246:Loxhd1	UTSW	18	77363546	missense	possibly damaging	0.71
R8263:Loxhd1	UTSW	18	77375162	missense	probably damaging	1.00
R8324:Loxhd1	UTSW	18	77339579	critical splice donor site	probably null
R8342:Loxhd1	UTSW	18	77405985	missense	possibly damaging	0.88
R8401:Loxhd1	UTSW	18	77380460	missense	probably damaging	1.00
R8480:Loxhd1	UTSW	18	77431131	missense	probably damaging	1.00
R8490:Loxhd1	UTSW	18	77441466	missense	possibly damaging	0.96
R8807:Loxhd1	UTSW	18	77356772	missense	possibly damaging	0.93
R8961:Loxhd1	UTSW	18	77385069	missense	probably damaging	1.00
R8974:Loxhd1	UTSW	18	77431203	missense	possibly damaging	0.88
R9079:Loxhd1	UTSW	18	77402897	missense	probably benign
R9284:Loxhd1	UTSW	18	77414130	missense	probably damaging	0.97
R9312:Loxhd1	UTSW	18	77410589	missense	probably benign	0.05
X0020:Loxhd1	UTSW	18	77339562	nonsense	probably null
X0024:Loxhd1	UTSW	18	77395403	missense	probably damaging	1.00
X0062:Loxhd1	UTSW	18	77441516	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCAAACCCGATACCTTTGCCCG -3'
(R):5'- AGGCTGGAGATCTGCCTCTAACTC -3'

Sequencing Primer
(F):5'- CCACGATCTCTTGCAGTGAT -3'
(R):5'- ACGTAGAACTCCTCCACAGA -3'

Posted On

2014-05-23