Incidental Mutation 'R1735:Loxhd1'
ID 199687
Institutional Source Beutler Lab
Gene Symbol Loxhd1
Ensembl Gene ENSMUSG00000032818
Gene Name lipoxygenase homology domains 1
Synonyms sba, 1700096C21Rik
MMRRC Submission 039767-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock # R1735 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 77281958-77442341 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 77404889 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Alanine at position 1342 (D1342A)
Ref Sequence ENSEMBL: ENSMUSP00000114988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096547] [ENSMUST00000123166] [ENSMUST00000123410] [ENSMUST00000148341]
AlphaFold C8YR32
Predicted Effect possibly damaging
Transcript: ENSMUST00000096547
AA Change: D1451A

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000094294
Gene: ENSMUSG00000032818
AA Change: D1451A

DomainStartEndE-ValueType
LH2 43 158 5.64e-5 SMART
LH2 172 290 1.64e-9 SMART
LH2 296 409 1.1e-4 SMART
LH2 425 539 4.02e-4 SMART
LH2 553 675 3.79e-6 SMART
LH2 684 800 5.92e-6 SMART
LH2 814 936 6.91e-8 SMART
low complexity region 945 954 N/A INTRINSIC
LH2 970 1086 4.81e-7 SMART
LH2 1101 1228 5.73e-3 SMART
LH2 1255 1375 8.82e-5 SMART
Pfam:PLAT 1424 1540 5.4e-10 PFAM
LH2 1553 1666 6.41e-3 SMART
LH2 1680 1799 6.76e-6 SMART
Pfam:PLAT 1813 1929 3.8e-9 PFAM
LH2 1949 2067 7.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123166
SMART Domains Protein: ENSMUSP00000116287
Gene: ENSMUSG00000032818

DomainStartEndE-ValueType
LH2 1 114 6.41e-3 SMART
LH2 128 247 6.76e-6 SMART
Pfam:PLAT 261 379 1.3e-8 PFAM
LH2 397 515 7.23e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123410
AA Change: D585A

PolyPhen 2 Score 0.112 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000120991
Gene: ENSMUSG00000032818
AA Change: D585A

DomainStartEndE-ValueType
Pfam:PLAT 1 67 4.4e-15 PFAM
low complexity region 79 88 N/A INTRINSIC
LH2 104 220 4.81e-7 SMART
LH2 235 362 5.73e-3 SMART
LH2 389 509 8.82e-5 SMART
Pfam:PLAT 558 674 9.9e-12 PFAM
LH2 687 800 6.41e-3 SMART
LH2 814 933 6.76e-6 SMART
Pfam:PLAT 947 1065 8.8e-9 PFAM
Pfam:PLAT 1085 1174 4.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148341
AA Change: D1342A

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114988
Gene: ENSMUSG00000032818
AA Change: D1342A

DomainStartEndE-ValueType
Pfam:PLAT 1 91 1.7e-11 PFAM
LH2 106 220 4.02e-4 SMART
LH2 234 356 3.79e-6 SMART
LH2 365 481 5.92e-6 SMART
LH2 495 610 7.67e-3 SMART
LH2 707 827 1.47e-11 SMART
low complexity region 836 845 N/A INTRINSIC
LH2 861 977 4.81e-7 SMART
LH2 992 1119 5.73e-3 SMART
LH2 1146 1266 8.82e-5 SMART
Pfam:PLAT 1384 1469 8.9e-14 PFAM
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 97.0%
  • 10x: 95.3%
  • 20x: 92.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice honozygous for an ENU-induced mutation exhibit hearing loss associated with hair cell and spiral ganglion degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230110C19Rik A C 9: 8,027,265 S91A probably benign Het
Acot5 A T 12: 84,075,487 I282F probably benign Het
Adam19 C A 11: 46,138,917 Q730K probably benign Het
Adgrv1 A G 13: 81,487,947 V3481A possibly damaging Het
Akr1c20 T C 13: 4,487,208 D316G probably benign Het
Ap3b1 G A 13: 94,493,717 V827I unknown Het
Aph1a T A 3: 95,895,509 D140E probably damaging Het
Arhgef19 G T 4: 141,249,618 V502L possibly damaging Het
Arl9 T C 5: 77,006,626 F67S probably damaging Het
B430305J03Rik G A 3: 61,363,940 probably benign Het
B4galnt2 A G 11: 95,890,983 F119L probably damaging Het
Bcap29 T A 12: 31,630,840 N49I probably damaging Het
C77080 G T 4: 129,223,577 S476R probably damaging Het
Capn11 T A 17: 45,632,401 K616* probably null Het
Cdh12 T A 15: 21,520,366 Y306N probably damaging Het
Cep350 T A 1: 155,953,214 N315Y probably damaging Het
Cited2 C A 10: 17,724,046 P34Q probably damaging Het
Cmya5 A T 13: 93,089,789 D2930E probably benign Het
Cog3 T A 14: 75,729,321 K470* probably null Het
Commd10 A G 18: 46,990,485 T136A probably benign Het
Csf2ra C A 19: 61,226,344 D181Y probably damaging Het
Csmd1 T A 8: 15,932,610 I2686F probably damaging Het
Dhx29 T C 13: 112,945,086 S415P probably benign Het
Dsel A T 1: 111,860,915 F630Y probably damaging Het
Ell T A 8: 70,578,940 I96N possibly damaging Het
Ephx2 T A 14: 66,088,303 I358L probably benign Het
Fam162b A G 10: 51,587,211 I120T probably damaging Het
Fam187a T C 11: 102,885,780 Y137H probably damaging Het
Fastk T C 5: 24,441,803 E403G probably damaging Het
Fcrlb C A 1: 170,907,332 V409F probably benign Het
Flot2 G T 11: 78,058,005 A269S probably benign Het
Gpd2 T A 2: 57,355,551 N419K probably damaging Het
Hecw1 A T 13: 14,377,765 M61K probably null Het
Htr2a T C 14: 74,706,128 F383L probably damaging Het
Kctd6 C T 14: 8,222,253 R32C probably damaging Het
Khdc1a A G 1: 21,350,965 T125A probably benign Het
Klhl40 T C 9: 121,779,938 S390P probably benign Het
Lonp1 G A 17: 56,614,956 T808I probably damaging Het
Lrat T C 3: 82,897,110 I187V probably benign Het
Lrif1 T C 3: 106,735,846 *238Q probably null Het
Lrp2bp T C 8: 46,011,988 F48S probably benign Het
Mafg A G 11: 120,629,678 M32T possibly damaging Het
Map4 C T 9: 110,034,955 T416I probably benign Het
N4bp2 T C 5: 65,808,316 F1236S probably damaging Het
Nfatc3 A G 8: 106,083,834 D414G probably damaging Het
Nrip2 T G 6: 128,405,074 V50G probably damaging Het
Olfr1449 T A 19: 12,934,843 I35N probably damaging Het
Olfr16 A G 1: 172,956,807 N4S probably benign Het
Olfr432 A T 1: 174,050,799 K142I probably benign Het
Olfr608 T A 7: 103,470,146 F36I possibly damaging Het
Pcdhb18 A T 18: 37,490,769 H384L probably benign Het
Pik3r1 A T 13: 101,686,374 Y607N probably damaging Het
Plagl2 G A 2: 153,232,477 T168I probably damaging Het
Polr2a A G 11: 69,742,396 S912P probably damaging Het
Ppp1r16b A G 2: 158,761,495 K447E possibly damaging Het
Prkd1 T C 12: 50,342,039 E907G possibly damaging Het
Rabep2 A G 7: 126,444,540 R470G probably damaging Het
Rasal2 T C 1: 157,174,160 Y518C probably damaging Het
Rbmxl1 A G 8: 78,506,082 Y211H probably damaging Het
Rdh7 T C 10: 127,884,585 Y306C probably benign Het
Rtn3 T C 19: 7,457,911 I220V probably damaging Het
Scn8a A G 15: 101,015,861 N1045D possibly damaging Het
Scube1 T C 15: 83,607,437 H952R probably damaging Het
Sf3b1 A G 1: 55,000,652 I690T probably damaging Het
Sharpin T C 15: 76,347,936 K240R probably benign Het
Skint5 A G 4: 113,563,459 I1108T unknown Het
Snip1 A G 4: 125,071,201 D133G probably benign Het
St3gal3 T C 4: 118,014,774 Y77C probably damaging Het
Sytl3 T C 17: 6,715,481 V112A probably benign Het
Tnxb C T 17: 34,717,970 P3718S probably damaging Het
Ttc24 A T 3: 88,073,094 probably null Het
Ubr3 A T 2: 70,009,129 E1529V probably damaging Het
Utrn T A 10: 12,710,138 H965L probably benign Het
Xrn2 T A 2: 147,061,423 L781Q probably damaging Het
Zbtb11 T C 16: 55,990,682 I401T probably benign Het
Zc3h14 C T 12: 98,758,580 P167L probably damaging Het
Zfp609 G T 9: 65,703,092 S863* probably null Het
Other mutations in Loxhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00330:Loxhd1 APN 18 77395450 missense probably damaging 0.99
IGL00490:Loxhd1 APN 18 77431074 missense possibly damaging 0.94
IGL00507:Loxhd1 APN 18 77332567 missense probably benign 0.03
IGL00546:Loxhd1 APN 18 77405976 missense probably damaging 0.97
IGL01369:Loxhd1 APN 18 77329201 missense possibly damaging 0.85
IGL01767:Loxhd1 APN 18 77286424 missense possibly damaging 0.71
IGL02245:Loxhd1 APN 18 77340101 missense possibly damaging 0.71
IGL02388:Loxhd1 APN 18 77369137 missense probably benign 0.18
IGL02410:Loxhd1 APN 18 77402952 missense probably benign 0.02
IGL02593:Loxhd1 APN 18 77410539 missense possibly damaging 0.91
IGL02632:Loxhd1 APN 18 77405932 missense probably damaging 0.99
IGL02692:Loxhd1 APN 18 77356913 missense probably damaging 0.99
IGL02796:Loxhd1 APN 18 77369115 splice site probably benign
IGL03032:Loxhd1 APN 18 77286473 missense possibly damaging 0.93
IGL03074:Loxhd1 APN 18 77441784 missense possibly damaging 0.75
IGL03094:Loxhd1 APN 18 77431113 missense possibly damaging 0.88
IGL03118:Loxhd1 APN 18 77380464 missense probably damaging 1.00
IGL03232:Loxhd1 APN 18 77408750 missense probably damaging 1.00
IGL03377:Loxhd1 APN 18 77441673 missense possibly damaging 0.91
H8562:Loxhd1 UTSW 18 77341931 missense possibly damaging 0.93
PIT4494001:Loxhd1 UTSW 18 77441768 missense probably damaging 0.99
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0003:Loxhd1 UTSW 18 77339500 missense probably damaging 0.98
R0048:Loxhd1 UTSW 18 77408778 missense probably damaging 0.99
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0049:Loxhd1 UTSW 18 77380560 splice site probably benign
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0206:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0208:Loxhd1 UTSW 18 77404866 missense possibly damaging 0.90
R0323:Loxhd1 UTSW 18 77369137 missense probably benign 0.18
R0332:Loxhd1 UTSW 18 77383830 splice site probably null
R0367:Loxhd1 UTSW 18 77425757 splice site probably benign
R0709:Loxhd1 UTSW 18 77404969 missense probably benign 0.23
R0783:Loxhd1 UTSW 18 77429984 missense possibly damaging 0.58
R1132:Loxhd1 UTSW 18 77429943 missense possibly damaging 0.71
R1232:Loxhd1 UTSW 18 77406003 critical splice donor site probably null
R1331:Loxhd1 UTSW 18 77402936 missense possibly damaging 0.86
R1465:Loxhd1 UTSW 18 77380573 splice site probably null
R1465:Loxhd1 UTSW 18 77380573 splice site probably null
R1501:Loxhd1 UTSW 18 77356832 missense probably damaging 1.00
R1640:Loxhd1 UTSW 18 77402563 missense probably damaging 1.00
R1656:Loxhd1 UTSW 18 77321668 missense possibly damaging 0.71
R1671:Loxhd1 UTSW 18 77404802 missense probably damaging 1.00
R1725:Loxhd1 UTSW 18 77293241 missense probably benign 0.32
R1796:Loxhd1 UTSW 18 77405907 missense probably damaging 0.96
R1796:Loxhd1 UTSW 18 77425639 missense possibly damaging 0.88
R1800:Loxhd1 UTSW 18 77402502 missense probably damaging 1.00
R1848:Loxhd1 UTSW 18 77281971 missense possibly damaging 0.53
R1912:Loxhd1 UTSW 18 77340137 missense probably benign 0.32
R1945:Loxhd1 UTSW 18 77404808 missense probably damaging 1.00
R1978:Loxhd1 UTSW 18 77321642 missense possibly damaging 0.86
R1997:Loxhd1 UTSW 18 77295769 missense probably damaging 0.98
R2086:Loxhd1 UTSW 18 77384946 missense probably damaging 1.00
R2153:Loxhd1 UTSW 18 77356166 missense possibly damaging 0.72
R3124:Loxhd1 UTSW 18 77431078 missense probably damaging 0.97
R3896:Loxhd1 UTSW 18 77382023 missense possibly damaging 0.65
R3907:Loxhd1 UTSW 18 77408768 missense possibly damaging 0.60
R3980:Loxhd1 UTSW 18 77414159 missense probably damaging 1.00
R4165:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4166:Loxhd1 UTSW 18 77372329 missense probably damaging 0.99
R4176:Loxhd1 UTSW 18 77331059 missense possibly damaging 0.53
R4345:Loxhd1 UTSW 18 77399001 missense possibly damaging 0.89
R4354:Loxhd1 UTSW 18 77395427 missense probably damaging 1.00
R4385:Loxhd1 UTSW 18 77372911 missense probably damaging 0.99
R4402:Loxhd1 UTSW 18 77441760 missense possibly damaging 0.94
R4404:Loxhd1 UTSW 18 77431132 missense probably damaging 1.00
R4456:Loxhd1 UTSW 18 77399089 missense probably damaging 1.00
R4525:Loxhd1 UTSW 18 77356912 missense probably damaging 0.98
R4605:Loxhd1 UTSW 18 77405946 missense probably benign 0.00
R4661:Loxhd1 UTSW 18 77402885 missense possibly damaging 0.79
R4698:Loxhd1 UTSW 18 77372291 missense possibly damaging 0.82
R4725:Loxhd1 UTSW 18 77395457 missense probably damaging 1.00
R4820:Loxhd1 UTSW 18 77384967 missense probably damaging 1.00
R5163:Loxhd1 UTSW 18 77361736 missense possibly damaging 0.92
R5288:Loxhd1 UTSW 18 77363612 missense probably damaging 1.00
R5328:Loxhd1 UTSW 18 77410572 missense probably damaging 1.00
R5329:Loxhd1 UTSW 18 77332682 missense probably damaging 0.98
R5347:Loxhd1 UTSW 18 77366541 missense probably damaging 1.00
R5589:Loxhd1 UTSW 18 77342055 missense possibly damaging 0.86
R5616:Loxhd1 UTSW 18 77404951 missense probably damaging 1.00
R5703:Loxhd1 UTSW 18 77356877 missense probably damaging 1.00
R5837:Loxhd1 UTSW 18 77286409 missense possibly damaging 0.71
R5888:Loxhd1 UTSW 18 77402515 missense probably damaging 0.99
R6021:Loxhd1 UTSW 18 77412250 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6032:Loxhd1 UTSW 18 77381558 missense probably damaging 1.00
R6153:Loxhd1 UTSW 18 77295758 missense possibly damaging 0.71
R6174:Loxhd1 UTSW 18 77412178 missense probably damaging 1.00
R6265:Loxhd1 UTSW 18 77361730 missense probably damaging 0.99
R6377:Loxhd1 UTSW 18 77380432 missense probably damaging 1.00
R6530:Loxhd1 UTSW 18 77412151 missense probably benign 0.30
R6555:Loxhd1 UTSW 18 77293269 missense possibly damaging 0.51
R6782:Loxhd1 UTSW 18 77431177 missense probably damaging 0.99
R6834:Loxhd1 UTSW 18 77441526 missense probably damaging 1.00
R7000:Loxhd1 UTSW 18 77372433 critical splice donor site probably null
R7112:Loxhd1 UTSW 18 77388514 missense probably damaging 1.00
R7203:Loxhd1 UTSW 18 77414196 missense probably damaging 0.97
R7206:Loxhd1 UTSW 18 77441817 missense probably damaging 0.97
R7260:Loxhd1 UTSW 18 77332642 missense possibly damaging 0.93
R7432:Loxhd1 UTSW 18 77295851 missense possibly damaging 0.51
R7475:Loxhd1 UTSW 18 77412305 missense possibly damaging 0.83
R7555:Loxhd1 UTSW 18 77395365 missense probably damaging 0.99
R7590:Loxhd1 UTSW 18 77321634 missense possibly damaging 0.84
R7612:Loxhd1 UTSW 18 77429975 missense possibly damaging 0.95
R7626:Loxhd1 UTSW 18 77431186 missense possibly damaging 0.75
R7768:Loxhd1 UTSW 18 77384941 missense probably damaging 0.99
R7791:Loxhd1 UTSW 18 77383729 missense probably damaging 1.00
R7829:Loxhd1 UTSW 18 77408787 missense probably damaging 0.99
R7884:Loxhd1 UTSW 18 77431213 missense probably damaging 0.98
R7960:Loxhd1 UTSW 18 77385050 missense probably damaging 0.99
R7986:Loxhd1 UTSW 18 77375194 missense possibly damaging 0.88
R8042:Loxhd1 UTSW 18 77431192 missense probably damaging 0.99
R8084:Loxhd1 UTSW 18 77340149 missense possibly damaging 0.71
R8088:Loxhd1 UTSW 18 77342013 missense possibly damaging 0.52
R8100:Loxhd1 UTSW 18 77404816 missense possibly damaging 0.69
R8139:Loxhd1 UTSW 18 77380496 missense possibly damaging 0.95
R8152:Loxhd1 UTSW 18 77388399 missense possibly damaging 0.62
R8199:Loxhd1 UTSW 18 77381638 missense possibly damaging 0.77
R8246:Loxhd1 UTSW 18 77363546 missense possibly damaging 0.71
R8263:Loxhd1 UTSW 18 77375162 missense probably damaging 1.00
R8324:Loxhd1 UTSW 18 77339579 critical splice donor site probably null
R8342:Loxhd1 UTSW 18 77405985 missense possibly damaging 0.88
R8401:Loxhd1 UTSW 18 77380460 missense probably damaging 1.00
R8480:Loxhd1 UTSW 18 77431131 missense probably damaging 1.00
R8490:Loxhd1 UTSW 18 77441466 missense possibly damaging 0.96
R8807:Loxhd1 UTSW 18 77356772 missense possibly damaging 0.93
R8961:Loxhd1 UTSW 18 77385069 missense probably damaging 1.00
R8974:Loxhd1 UTSW 18 77431203 missense possibly damaging 0.88
R9079:Loxhd1 UTSW 18 77402897 missense probably benign
R9284:Loxhd1 UTSW 18 77414130 missense probably damaging 0.97
R9312:Loxhd1 UTSW 18 77410589 missense probably benign 0.05
X0020:Loxhd1 UTSW 18 77339562 nonsense probably null
X0024:Loxhd1 UTSW 18 77395403 missense probably damaging 1.00
X0062:Loxhd1 UTSW 18 77441516 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAAACCCGATACCTTTGCCCG -3'
(R):5'- AGGCTGGAGATCTGCCTCTAACTC -3'

Sequencing Primer
(F):5'- CCACGATCTCTTGCAGTGAT -3'
(R):5'- ACGTAGAACTCCTCCACAGA -3'
Posted On 2014-05-23