Mutagenetix > Incidental Mutations

Incidental Mutation 'R1735:Rtn3'

199689

Institutional Source

Beutler Lab

Gene Symbol

Rtn3

Ensembl Gene

ENSMUSG00000024758

Gene Name

reticulon 3

Synonyms

MMRRC Submission

039767-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.176) question?

Stock #

R1735 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7425901-7483289 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 7457911 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 220 (I220V)

Ref Sequence

ENSEMBL: ENSMUSP00000085496 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025667] [ENSMUST00000065304] [ENSMUST00000088169] [ENSMUST00000088171]

AlphaFold

Q9ES97

Predicted Effect

probably benign
Transcript: ENSMUST00000025667

SMART Domains

Protein: ENSMUSP00000025667
Gene: ENSMUSG00000024758

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
Pfam:Reticulon	49	219	8.7e-58	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065304
AA Change: I239V

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000065810
Gene: ENSMUSG00000024758
AA Change: I239V

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
low complexity region	42	66	N/A	INTRINSIC
low complexity region	80	91	N/A	INTRINSIC
low complexity region	119	131	N/A	INTRINSIC
low complexity region	516	527	N/A	INTRINSIC
low complexity region	639	650	N/A	INTRINSIC
Pfam:Reticulon	776	940	9.1e-45	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000088169

SMART Domains

Protein: ENSMUSP00000085494
Gene: ENSMUSG00000024758

Domain	Start	End	E-Value	Type
low complexity region	4	40	N/A	INTRINSIC
low complexity region	42	66	N/A	INTRINSIC
Pfam:Reticulon	68	238	1.1e-57	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000088171
AA Change: I220V

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000085496
Gene: ENSMUSG00000024758
AA Change: I220V

Domain	Start	End	E-Value	Type
low complexity region	4	56	N/A	INTRINSIC
low complexity region	61	72	N/A	INTRINSIC
low complexity region	100	112	N/A	INTRINSIC
low complexity region	497	508	N/A	INTRINSIC
low complexity region	620	631	N/A	INTRINSIC
Pfam:Reticulon	757	927	1.8e-56	PFAM

Coding Region Coverage

1x: 97.6%
3x: 97.0%
10x: 95.3%
20x: 92.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the reticulon family of highly conserved genes that are preferentially expressed in neuroendocrine tissues. This family of proteins interact with, and modulate the activity of beta-amyloid converting enzyme 1 (BACE1), and the production of amyloid-beta. An increase in the expression of any reticulon protein substantially reduces the production of amyloid-beta, suggesting that reticulon proteins are negative modulators of BACE1 in cells. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, and pseudogenes of this gene are located on chromosomes 4 and 12. [provided by RefSeq, May 2012]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230110C19Rik	A	C	9: 8,027,265	S91A	probably benign	Het
Acot5	A	T	12: 84,075,487	I282F	probably benign	Het
Adam19	C	A	11: 46,138,917	Q730K	probably benign	Het
Adgrv1	A	G	13: 81,487,947	V3481A	possibly damaging	Het
Akr1c20	T	C	13: 4,487,208	D316G	probably benign	Het
Ap3b1	G	A	13: 94,493,717	V827I	unknown	Het
Aph1a	T	A	3: 95,895,509	D140E	probably damaging	Het
Arhgef19	G	T	4: 141,249,618	V502L	possibly damaging	Het
Arl9	T	C	5: 77,006,626	F67S	probably damaging	Het
B430305J03Rik	G	A	3: 61,363,940		probably benign	Het
B4galnt2	A	G	11: 95,890,983	F119L	probably damaging	Het
Bcap29	T	A	12: 31,630,840	N49I	probably damaging	Het
C77080	G	T	4: 129,223,577	S476R	probably damaging	Het
Capn11	T	A	17: 45,632,401	K616*	probably null	Het
Cdh12	T	A	15: 21,520,366	Y306N	probably damaging	Het
Cep350	T	A	1: 155,953,214	N315Y	probably damaging	Het
Cited2	C	A	10: 17,724,046	P34Q	probably damaging	Het
Cmya5	A	T	13: 93,089,789	D2930E	probably benign	Het
Cog3	T	A	14: 75,729,321	K470*	probably null	Het
Commd10	A	G	18: 46,990,485	T136A	probably benign	Het
Csf2ra	C	A	19: 61,226,344	D181Y	probably damaging	Het
Csmd1	T	A	8: 15,932,610	I2686F	probably damaging	Het
Dhx29	T	C	13: 112,945,086	S415P	probably benign	Het
Dsel	A	T	1: 111,860,915	F630Y	probably damaging	Het
Ell	T	A	8: 70,578,940	I96N	possibly damaging	Het
Ephx2	T	A	14: 66,088,303	I358L	probably benign	Het
Fam162b	A	G	10: 51,587,211	I120T	probably damaging	Het
Fam187a	T	C	11: 102,885,780	Y137H	probably damaging	Het
Fastk	T	C	5: 24,441,803	E403G	probably damaging	Het
Fcrlb	C	A	1: 170,907,332	V409F	probably benign	Het
Flot2	G	T	11: 78,058,005	A269S	probably benign	Het
Gpd2	T	A	2: 57,355,551	N419K	probably damaging	Het
Hecw1	A	T	13: 14,377,765	M61K	probably null	Het
Htr2a	T	C	14: 74,706,128	F383L	probably damaging	Het
Kctd6	C	T	14: 8,222,253	R32C	probably damaging	Het
Khdc1a	A	G	1: 21,350,965	T125A	probably benign	Het
Klhl40	T	C	9: 121,779,938	S390P	probably benign	Het
Lonp1	G	A	17: 56,614,956	T808I	probably damaging	Het
Loxhd1	A	C	18: 77,404,889	D1342A	probably damaging	Het
Lrat	T	C	3: 82,897,110	I187V	probably benign	Het
Lrif1	T	C	3: 106,735,846	*238Q	probably null	Het
Lrp2bp	T	C	8: 46,011,988	F48S	probably benign	Het
Mafg	A	G	11: 120,629,678	M32T	possibly damaging	Het
Map4	C	T	9: 110,034,955	T416I	probably benign	Het
N4bp2	T	C	5: 65,808,316	F1236S	probably damaging	Het
Nfatc3	A	G	8: 106,083,834	D414G	probably damaging	Het
Nrip2	T	G	6: 128,405,074	V50G	probably damaging	Het
Olfr1449	T	A	19: 12,934,843	I35N	probably damaging	Het
Olfr16	A	G	1: 172,956,807	N4S	probably benign	Het
Olfr432	A	T	1: 174,050,799	K142I	probably benign	Het
Olfr608	T	A	7: 103,470,146	F36I	possibly damaging	Het
Pcdhb18	A	T	18: 37,490,769	H384L	probably benign	Het
Pik3r1	A	T	13: 101,686,374	Y607N	probably damaging	Het
Plagl2	G	A	2: 153,232,477	T168I	probably damaging	Het
Polr2a	A	G	11: 69,742,396	S912P	probably damaging	Het
Ppp1r16b	A	G	2: 158,761,495	K447E	possibly damaging	Het
Prkd1	T	C	12: 50,342,039	E907G	possibly damaging	Het
Rabep2	A	G	7: 126,444,540	R470G	probably damaging	Het
Rasal2	T	C	1: 157,174,160	Y518C	probably damaging	Het
Rbmxl1	A	G	8: 78,506,082	Y211H	probably damaging	Het
Rdh7	T	C	10: 127,884,585	Y306C	probably benign	Het
Scn8a	A	G	15: 101,015,861	N1045D	possibly damaging	Het
Scube1	T	C	15: 83,607,437	H952R	probably damaging	Het
Sf3b1	A	G	1: 55,000,652	I690T	probably damaging	Het
Sharpin	T	C	15: 76,347,936	K240R	probably benign	Het
Skint5	A	G	4: 113,563,459	I1108T	unknown	Het
Snip1	A	G	4: 125,071,201	D133G	probably benign	Het
St3gal3	T	C	4: 118,014,774	Y77C	probably damaging	Het
Sytl3	T	C	17: 6,715,481	V112A	probably benign	Het
Tnxb	C	T	17: 34,717,970	P3718S	probably damaging	Het
Ttc24	A	T	3: 88,073,094		probably null	Het
Ubr3	A	T	2: 70,009,129	E1529V	probably damaging	Het
Utrn	T	A	10: 12,710,138	H965L	probably benign	Het
Xrn2	T	A	2: 147,061,423	L781Q	probably damaging	Het
Zbtb11	T	C	16: 55,990,682	I401T	probably benign	Het
Zc3h14	C	T	12: 98,758,580	P167L	probably damaging	Het
Zfp609	G	T	9: 65,703,092	S863*	probably null	Het

Other mutations in Rtn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00791:Rtn3	APN	19	7435069	missense	probably damaging	1.00
IGL01025:Rtn3	APN	19	7483041	missense	unknown
IGL01347:Rtn3	APN	19	7457280	missense	probably benign	0.01
IGL01845:Rtn3	APN	19	7457876	missense	probably damaging	1.00
IGL02217:Rtn3	APN	19	7435084	missense	probably damaging	0.99
IGL03024:Rtn3	APN	19	7483090	utr 5 prime	probably benign
R0399:Rtn3	UTSW	19	7457876	missense	probably damaging	1.00
R0633:Rtn3	UTSW	19	7457593	missense	probably benign	0.03
R0826:Rtn3	UTSW	19	7467880	intron	probably benign
R1327:Rtn3	UTSW	19	7431011	missense	possibly damaging	0.81
R2093:Rtn3	UTSW	19	7456850	missense	probably damaging	1.00
R3116:Rtn3	UTSW	19	7431990	missense	probably damaging	1.00
R3894:Rtn3	UTSW	19	7435085	missense	probably damaging	1.00
R3961:Rtn3	UTSW	19	7458145	missense	probably damaging	0.99
R3962:Rtn3	UTSW	19	7458145	missense	probably damaging	0.99
R3963:Rtn3	UTSW	19	7458145	missense	probably damaging	0.99
R4161:Rtn3	UTSW	19	7483079	missense	probably benign	0.38
R4960:Rtn3	UTSW	19	7456521	missense	probably damaging	1.00
R5585:Rtn3	UTSW	19	7458195	missense	probably benign	0.12
R5735:Rtn3	UTSW	19	7456692	missense	probably damaging	0.99
R5796:Rtn3	UTSW	19	7457467	missense	possibly damaging	0.48
R5807:Rtn3	UTSW	19	7456827	missense	probably damaging	1.00
R5864:Rtn3	UTSW	19	7435111	missense	probably damaging	1.00
R6322:Rtn3	UTSW	19	7458138	missense	possibly damaging	0.60
R6703:Rtn3	UTSW	19	7435045	missense	probably damaging	1.00
R6885:Rtn3	UTSW	19	7458331	missense	probably benign	0.31
R6888:Rtn3	UTSW	19	7457249	missense	probably benign	0.00
R6989:Rtn3	UTSW	19	7456491	missense	possibly damaging	0.95
R6992:Rtn3	UTSW	19	7435124	missense	probably damaging	1.00
R7506:Rtn3	UTSW	19	7429753	missense	probably benign	0.08
R7610:Rtn3	UTSW	19	7457929	missense	probably damaging	1.00
R7639:Rtn3	UTSW	19	7457991	missense	probably benign	0.01
R7909:Rtn3	UTSW	19	7456462	missense	possibly damaging	0.67
R7915:Rtn3	UTSW	19	7457500	missense	probably benign	0.06
R8088:Rtn3	UTSW	19	7434998	missense	probably damaging	1.00
R8549:Rtn3	UTSW	19	7457259	missense	probably benign	0.03
R8725:Rtn3	UTSW	19	7457361	missense	probably benign
R8727:Rtn3	UTSW	19	7457361	missense	probably benign
R8917:Rtn3	UTSW	19	7456740	missense	possibly damaging	0.78
R9225:Rtn3	UTSW	19	7457489	missense	probably damaging	1.00
R9336:Rtn3	UTSW	19	7482963	missense	unknown
X0060:Rtn3	UTSW	19	7432571	missense	possibly damaging	0.80
Z1192:Rtn3	UTSW	19	7482977	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTACCGAGCAGTACAGAGGATGG -3'
(R):5'- AAAACTGGACTCACCTCAGGGGAC -3'

Sequencing Primer
(F):5'- AGGATGGGTAACGCCCTG -3'
(R):5'- TATTCCAGACAGTTTCCCAGAG -3'

Posted On

2014-05-23