Incidental Mutation 'R1736:Sphkap'
ID199695
Institutional Source Beutler Lab
Gene Symbol Sphkap
Ensembl Gene ENSMUSG00000026163
Gene NameSPHK1 interactor, AKAP domain containing
Synonyms4930544G21Rik, A930009L15Rik, SKIP
MMRRC Submission 039768-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R1736 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location83254139-83408200 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 83277515 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 838 (R838*)
Ref Sequence ENSEMBL: ENSMUSP00000124872 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159078] [ENSMUST00000160953]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053075
Predicted Effect probably null
Transcript: ENSMUST00000159078
AA Change: R551*
SMART Domains Protein: ENSMUSP00000124384
Gene: ENSMUSG00000026163
AA Change: R551*

DomainStartEndE-ValueType
low complexity region 303 314 N/A INTRINSIC
SCOP:d1ash__ 382 462 5e-3 SMART
low complexity region 809 819 N/A INTRINSIC
low complexity region 854 865 N/A INTRINSIC
low complexity region 1202 1221 N/A INTRINSIC
low complexity region 1243 1254 N/A INTRINSIC
Pfam:AKAP_110 1281 1398 7.5e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160953
AA Change: R838*
SMART Domains Protein: ENSMUSP00000124872
Gene: ENSMUSG00000026163
AA Change: R838*

DomainStartEndE-ValueType
low complexity region 590 601 N/A INTRINSIC
SCOP:d1ash__ 669 749 6e-3 SMART
low complexity region 1096 1106 N/A INTRINSIC
low complexity region 1141 1152 N/A INTRINSIC
low complexity region 1489 1508 N/A INTRINSIC
Pfam:AKAP_110 1540 1655 6.4e-12 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy3 A G 12: 4,200,998 N586D possibly damaging Het
Ak6 T A 13: 100,655,181 probably null Het
Ankrd66 T C 17: 43,543,518 D41G probably benign Het
Atp8b2 G A 3: 89,952,694 P339S probably damaging Het
BC025446 G A 15: 75,217,720 G26R probably damaging Het
Cacna1d C T 14: 30,089,863 V1297I probably damaging Het
Cbl A T 9: 44,152,895 D781E possibly damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Clint1 A G 11: 45,906,177 probably null Het
Col6a3 A G 1: 90,779,059 Y2111H unknown Het
Csnk1g1 A G 9: 66,019,915 probably null Het
Dse A T 10: 34,153,149 N648K probably damaging Het
Dsp A G 13: 38,192,990 K1584E probably benign Het
Ezh2 A T 6: 47,576,660 M41K probably damaging Het
Fam71e2 A G 7: 4,758,154 S520P probably damaging Het
Fscn2 G A 11: 120,368,026 G466S probably damaging Het
Gm15217 A G 14: 46,383,206 probably benign Het
Gm9696 T C 3: 59,972,275 noncoding transcript Het
Gosr2 G A 11: 103,679,250 Q162* probably null Het
Hectd4 T A 5: 121,349,530 H3529Q possibly damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2c A T 5: 25,290,527 I4074K probably damaging Het
Map3k11 A G 19: 5,697,401 D555G probably benign Het
Mindy2 A G 9: 70,631,030 I341T probably damaging Het
Mrnip G A 11: 50,176,891 probably null Het
Muc5b G A 7: 141,859,107 C1930Y unknown Het
Nfatc3 T G 8: 106,078,850 I109S probably damaging Het
Npas1 G T 7: 16,474,616 A112D probably benign Het
Npffr2 T A 5: 89,568,066 I84N probably damaging Het
Nxph4 T A 10: 127,526,596 H142L probably damaging Het
Otud4 T A 8: 79,651,665 probably benign Het
Per3 A G 4: 151,009,248 probably null Het
Pigr G A 1: 130,841,803 R117Q possibly damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prex2 T A 1: 11,089,884 probably benign Het
Sall4 G A 2: 168,752,635 P420L probably benign Het
Sap30bp A G 11: 115,964,220 K252R probably damaging Het
Sec63 T A 10: 42,827,918 Y692* probably null Het
Sema3e C T 5: 14,210,376 T181M probably damaging Het
Sf3b3 T C 8: 110,813,832 I986V probably benign Het
Shisa4 A T 1: 135,371,962 Y194* probably null Het
Slc17a6 G A 7: 51,661,585 probably benign Het
Smg1 T G 7: 118,165,967 probably null Het
Smim7 C T 8: 72,571,005 G9R probably damaging Het
Spata31d1d C T 13: 59,726,497 G1075R probably benign Het
Stag3 T C 5: 138,304,509 probably benign Het
Tbce A G 13: 14,009,642 I217T possibly damaging Het
Tpk1 G A 6: 43,611,350 P27S probably benign Het
Tsc22d1 A G 14: 76,418,357 I2V probably benign Het
Tulp4 T G 17: 6,233,215 V1173G possibly damaging Het
Uchl1 T C 5: 66,677,074 probably null Het
Ugt2b38 T A 5: 87,423,633 Q180L probably benign Het
Other mutations in Sphkap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Sphkap APN 1 83280516 missense probably damaging 1.00
IGL00337:Sphkap APN 1 83339608 missense probably damaging 1.00
IGL00470:Sphkap APN 1 83277910 missense possibly damaging 0.87
IGL00577:Sphkap APN 1 83278844 missense probably damaging 1.00
IGL00657:Sphkap APN 1 83276375 missense probably damaging 1.00
IGL01868:Sphkap APN 1 83280399 unclassified probably null
IGL02101:Sphkap APN 1 83290987 missense probably damaging 1.00
IGL02471:Sphkap APN 1 83276176 missense probably damaging 1.00
IGL02943:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL02945:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03008:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03031:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03059:Sphkap APN 1 83257242 missense probably damaging 0.97
IGL03085:Sphkap APN 1 83280354 missense possibly damaging 0.92
IGL03355:Sphkap APN 1 83280503 missense probably damaging 1.00
IGL03356:Sphkap APN 1 83276831 missense probably damaging 1.00
IGL03368:Sphkap APN 1 83275676 missense probably benign 0.14
R0294:Sphkap UTSW 1 83278245 missense possibly damaging 0.72
R0308:Sphkap UTSW 1 83276969 missense probably damaging 1.00
R0478:Sphkap UTSW 1 83278711 missense probably damaging 1.00
R0606:Sphkap UTSW 1 83280424 missense probably damaging 1.00
R0678:Sphkap UTSW 1 83278628 missense probably benign 0.03
R1216:Sphkap UTSW 1 83290977 missense probably damaging 1.00
R1253:Sphkap UTSW 1 83278898 missense possibly damaging 0.56
R1532:Sphkap UTSW 1 83257203 missense probably damaging 1.00
R1635:Sphkap UTSW 1 83278400 missense probably benign 0.03
R1655:Sphkap UTSW 1 83277515 nonsense probably null
R1657:Sphkap UTSW 1 83277515 nonsense probably null
R1700:Sphkap UTSW 1 83277515 nonsense probably null
R1701:Sphkap UTSW 1 83277515 nonsense probably null
R1734:Sphkap UTSW 1 83277515 nonsense probably null
R1743:Sphkap UTSW 1 83277515 nonsense probably null
R1744:Sphkap UTSW 1 83277515 nonsense probably null
R1760:Sphkap UTSW 1 83277544 missense probably benign 0.29
R1893:Sphkap UTSW 1 83278966 missense probably benign 0.02
R1937:Sphkap UTSW 1 83267441 nonsense probably null
R1986:Sphkap UTSW 1 83277922 missense probably damaging 1.00
R1993:Sphkap UTSW 1 83277515 nonsense probably null
R1995:Sphkap UTSW 1 83277515 nonsense probably null
R2001:Sphkap UTSW 1 83276662 missense probably damaging 1.00
R2004:Sphkap UTSW 1 83277911 missense probably benign 0.04
R2111:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2112:Sphkap UTSW 1 83275881 missense probably benign 0.00
R2156:Sphkap UTSW 1 83277989 missense probably benign 0.03
R2182:Sphkap UTSW 1 83276684 missense probably damaging 1.00
R2271:Sphkap UTSW 1 83257221 missense probably damaging 1.00
R3712:Sphkap UTSW 1 83277112 missense probably benign 0.27
R3919:Sphkap UTSW 1 83276458 missense probably damaging 1.00
R3980:Sphkap UTSW 1 83267494 splice site probably null
R4130:Sphkap UTSW 1 83277898 missense probably damaging 0.96
R4539:Sphkap UTSW 1 83277793 missense probably benign 0.00
R4602:Sphkap UTSW 1 83279061 nonsense probably null
R4735:Sphkap UTSW 1 83279117 missense probably benign 0.01
R4793:Sphkap UTSW 1 83278084 missense possibly damaging 0.77
R4849:Sphkap UTSW 1 83277384 missense probably benign 0.03
R4880:Sphkap UTSW 1 83288817 missense probably damaging 1.00
R5213:Sphkap UTSW 1 83280503 missense probably damaging 1.00
R5277:Sphkap UTSW 1 83276164 missense probably benign 0.04
R5331:Sphkap UTSW 1 83276782 missense probably benign 0.08
R5632:Sphkap UTSW 1 83278285 missense probably benign 0.01
R5647:Sphkap UTSW 1 83407999 missense probably damaging 0.98
R5751:Sphkap UTSW 1 83275897 missense probably benign 0.27
R5935:Sphkap UTSW 1 83339599 missense probably damaging 1.00
R5999:Sphkap UTSW 1 83267405 missense probably benign 0.02
R6232:Sphkap UTSW 1 83280479 missense probably damaging 1.00
R6318:Sphkap UTSW 1 83278378 missense probably damaging 1.00
R6474:Sphkap UTSW 1 83278823 missense probably damaging 1.00
R6602:Sphkap UTSW 1 83275758 missense possibly damaging 0.75
R6674:Sphkap UTSW 1 83277834 missense probably benign 0.37
R6716:Sphkap UTSW 1 83362228 critical splice donor site probably null
R6803:Sphkap UTSW 1 83280510 missense probably damaging 1.00
R6880:Sphkap UTSW 1 83257257 missense probably damaging 1.00
R6941:Sphkap UTSW 1 83408090 start gained probably benign
R7170:Sphkap UTSW 1 83265985 missense probably damaging 0.99
R7263:Sphkap UTSW 1 83276678 missense probably damaging 1.00
R7422:Sphkap UTSW 1 83263826 missense probably benign 0.02
R7640:Sphkap UTSW 1 83278928 missense possibly damaging 0.94
R7722:Sphkap UTSW 1 83278921 missense probably benign 0.00
R7810:Sphkap UTSW 1 83276300 missense probably damaging 1.00
R7887:Sphkap UTSW 1 83277412 missense probably benign 0.00
R7970:Sphkap UTSW 1 83277412 missense probably benign 0.00
Z1088:Sphkap UTSW 1 83276608 missense probably damaging 1.00
Z1088:Sphkap UTSW 1 83278604 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGACCTCGGACTGCTTTGCCTC -3'
(R):5'- AGCCAGCCTCTTAGCAATGCAC -3'

Sequencing Primer
(F):5'- TCTAGAGTAGACTGAGCAGGAAC -3'
(R):5'- ACTGGCCTTGTCATCAGGAATC -3'
Posted On2014-05-23