Incidental Mutation 'R1736:Ces4a'
ID199719
Institutional Source Beutler Lab
Gene Symbol Ces4a
Ensembl Gene ENSMUSG00000060560
Gene Namecarboxylesterase 4A
SynonymsCes8
MMRRC Submission 039768-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1736 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location105131800-105150109 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 105138097 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Serine at position 69 (G69S)
Ref Sequence ENSEMBL: ENSMUSP00000125062 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000161289]
Predicted Effect probably damaging
Transcript: ENSMUST00000161289
AA Change: G69S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125062
Gene: ENSMUSG00000060560
AA Change: G69S

DomainStartEndE-ValueType
Pfam:COesterase 8 554 4.9e-163 PFAM
Pfam:Abhydrolase_3 143 319 2e-9 PFAM
Meta Mutation Damage Score 0.7473 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES6, encodes a secreted enzyme, and may play a role in the detoxification of drugs and xenobiotics in neural and other tissues of the body and in the cerebrospinal fluid. Multiple transcript variants encoding different isoforms have been reported, but the full-length nature and/or biological validity of some variants have not been determined. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy3 A G 12: 4,200,998 N586D possibly damaging Het
Ak6 T A 13: 100,655,181 probably null Het
Ankrd66 T C 17: 43,543,518 D41G probably benign Het
Atp8b2 G A 3: 89,952,694 P339S probably damaging Het
BC025446 G A 15: 75,217,720 G26R probably damaging Het
Cacna1d C T 14: 30,089,863 V1297I probably damaging Het
Cbl A T 9: 44,152,895 D781E possibly damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Clint1 A G 11: 45,906,177 probably null Het
Col6a3 A G 1: 90,779,059 Y2111H unknown Het
Csnk1g1 A G 9: 66,019,915 probably null Het
Dse A T 10: 34,153,149 N648K probably damaging Het
Dsp A G 13: 38,192,990 K1584E probably benign Het
Ezh2 A T 6: 47,576,660 M41K probably damaging Het
Fam71e2 A G 7: 4,758,154 S520P probably damaging Het
Fscn2 G A 11: 120,368,026 G466S probably damaging Het
Gm15217 A G 14: 46,383,206 probably benign Het
Gm9696 T C 3: 59,972,275 noncoding transcript Het
Gosr2 G A 11: 103,679,250 Q162* probably null Het
Hectd4 T A 5: 121,349,530 H3529Q possibly damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2c A T 5: 25,290,527 I4074K probably damaging Het
Map3k11 A G 19: 5,697,401 D555G probably benign Het
Mindy2 A G 9: 70,631,030 I341T probably damaging Het
Mrnip G A 11: 50,176,891 probably null Het
Muc5b G A 7: 141,859,107 C1930Y unknown Het
Nfatc3 T G 8: 106,078,850 I109S probably damaging Het
Npas1 G T 7: 16,474,616 A112D probably benign Het
Npffr2 T A 5: 89,568,066 I84N probably damaging Het
Nxph4 T A 10: 127,526,596 H142L probably damaging Het
Otud4 T A 8: 79,651,665 probably benign Het
Per3 A G 4: 151,009,248 probably null Het
Pigr G A 1: 130,841,803 R117Q possibly damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prex2 T A 1: 11,089,884 probably benign Het
Sall4 G A 2: 168,752,635 P420L probably benign Het
Sap30bp A G 11: 115,964,220 K252R probably damaging Het
Sec63 T A 10: 42,827,918 Y692* probably null Het
Sema3e C T 5: 14,210,376 T181M probably damaging Het
Sf3b3 T C 8: 110,813,832 I986V probably benign Het
Shisa4 A T 1: 135,371,962 Y194* probably null Het
Slc17a6 G A 7: 51,661,585 probably benign Het
Smg1 T G 7: 118,165,967 probably null Het
Smim7 C T 8: 72,571,005 G9R probably damaging Het
Spata31d1d C T 13: 59,726,497 G1075R probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stag3 T C 5: 138,304,509 probably benign Het
Tbce A G 13: 14,009,642 I217T possibly damaging Het
Tpk1 G A 6: 43,611,350 P27S probably benign Het
Tsc22d1 A G 14: 76,418,357 I2V probably benign Het
Tulp4 T G 17: 6,233,215 V1173G possibly damaging Het
Uchl1 T C 5: 66,677,074 probably null Het
Ugt2b38 T A 5: 87,423,633 Q180L probably benign Het
Other mutations in Ces4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00584:Ces4a APN 8 105145163 missense probably benign 0.00
IGL01574:Ces4a APN 8 105145227 splice site probably benign
IGL01655:Ces4a APN 8 105147174 missense probably damaging 0.99
IGL03092:Ces4a APN 8 105148204 splice site probably benign
IGL03151:Ces4a APN 8 105148197 critical splice donor site probably null
F6893:Ces4a UTSW 8 105147227 missense possibly damaging 0.74
R0266:Ces4a UTSW 8 105141966 missense probably benign
R0659:Ces4a UTSW 8 105144922 splice site probably benign
R1239:Ces4a UTSW 8 105149498 missense probably damaging 1.00
R1467:Ces4a UTSW 8 105138035 missense possibly damaging 0.56
R1467:Ces4a UTSW 8 105138035 missense possibly damaging 0.56
R1505:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1509:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1598:Ces4a UTSW 8 105142821 missense probably damaging 1.00
R1734:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1737:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1738:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1744:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1789:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1951:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R1953:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2126:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2129:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R2202:Ces4a UTSW 8 105146114 missense probably damaging 1.00
R4512:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R4865:Ces4a UTSW 8 105147158 missense probably benign 0.05
R4934:Ces4a UTSW 8 105137981 missense probably benign 0.30
R4936:Ces4a UTSW 8 105138097 missense probably damaging 1.00
R5255:Ces4a UTSW 8 105142489 missense probably benign 0.00
R5342:Ces4a UTSW 8 105146143 missense probably benign 0.07
R5647:Ces4a UTSW 8 105146080 missense probably benign 0.10
R6062:Ces4a UTSW 8 105138174 critical splice donor site probably null
R6490:Ces4a UTSW 8 105149458 missense probably benign 0.09
R6606:Ces4a UTSW 8 105149378 missense possibly damaging 0.95
R6876:Ces4a UTSW 8 105144992 missense possibly damaging 0.56
R6901:Ces4a UTSW 8 105146698 missense probably benign
R7519:Ces4a UTSW 8 105145219 missense probably damaging 1.00
R7682:Ces4a UTSW 8 105146665 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGCAGATGTACCAGAATCCCATCC -3'
(R):5'- AACCGAAGCCAAGAATAGGTTCCAG -3'

Sequencing Primer
(F):5'- CATGGTTGAGAAGCATAAGAAGAC -3'
(R):5'- CCAAGAATAGGTTCCAGGTTTGC -3'
Posted On2014-05-23