Incidental Mutation 'R1736:Tulp4'
ID199747
Institutional Source Beutler Lab
Gene Symbol Tulp4
Ensembl Gene ENSMUSG00000034377
Gene Nametubby like protein 4
Synonyms2210038L17Rik, 1110057P05Rik
MMRRC Submission 039768-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R1736 (G1)
Quality Score176
Status Not validated
Chromosome17
Chromosomal Location6106437-6251128 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 6233215 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 1173 (V1173G)
Ref Sequence ENSEMBL: ENSMUSP00000049248 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039655] [ENSMUST00000149756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039655
AA Change: V1173G

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049248
Gene: ENSMUSG00000034377
AA Change: V1173G

DomainStartEndE-ValueType
WD40 71 110 2.49e-1 SMART
Blast:WD40 113 153 9e-21 BLAST
WD40 159 195 1.84e1 SMART
low complexity region 226 238 N/A INTRINSIC
Blast:WD40 275 306 8e-8 BLAST
Blast:WD40 330 371 1e-14 BLAST
SOCS_box 374 411 2.31e-1 SMART
SCOP:d1c8za_ 418 505 1e-18 SMART
low complexity region 509 518 N/A INTRINSIC
low complexity region 528 547 N/A INTRINSIC
SCOP:d1c8za_ 594 669 8e-12 SMART
low complexity region 770 789 N/A INTRINSIC
low complexity region 837 864 N/A INTRINSIC
low complexity region 1021 1026 N/A INTRINSIC
low complexity region 1041 1056 N/A INTRINSIC
low complexity region 1174 1181 N/A INTRINSIC
low complexity region 1188 1197 N/A INTRINSIC
Pfam:Tub 1346 1543 2e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000137063
AA Change: V188G
SMART Domains Protein: ENSMUSP00000123119
Gene: ENSMUSG00000034377
AA Change: V188G

DomainStartEndE-ValueType
low complexity region 37 42 N/A INTRINSIC
low complexity region 57 72 N/A INTRINSIC
low complexity region 190 197 N/A INTRINSIC
low complexity region 204 213 N/A INTRINSIC
Pfam:Tub 345 537 3.3e-11 PFAM
low complexity region 603 639 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149756
AA Change: V980G

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000123218
Gene: ENSMUSG00000034377
AA Change: V980G

DomainStartEndE-ValueType
low complexity region 33 45 N/A INTRINSIC
Blast:WD40 82 113 6e-8 BLAST
Blast:WD40 137 178 1e-14 BLAST
SOCS_box 181 218 2.31e-1 SMART
SCOP:d1c8za_ 225 312 2e-18 SMART
low complexity region 316 325 N/A INTRINSIC
low complexity region 335 354 N/A INTRINSIC
SCOP:d1c8za_ 401 476 9e-12 SMART
low complexity region 577 596 N/A INTRINSIC
low complexity region 644 671 N/A INTRINSIC
low complexity region 828 833 N/A INTRINSIC
low complexity region 848 863 N/A INTRINSIC
low complexity region 981 988 N/A INTRINSIC
low complexity region 995 1004 N/A INTRINSIC
coiled coil region 1187 1215 N/A INTRINSIC
Pfam:Tub 1224 1350 5.3e-26 PFAM
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (57/59)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy3 A G 12: 4,200,998 N586D possibly damaging Het
Ak6 T A 13: 100,655,181 probably null Het
Ankrd66 T C 17: 43,543,518 D41G probably benign Het
Atp8b2 G A 3: 89,952,694 P339S probably damaging Het
BC025446 G A 15: 75,217,720 G26R probably damaging Het
Cacna1d C T 14: 30,089,863 V1297I probably damaging Het
Cbl A T 9: 44,152,895 D781E possibly damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Clint1 A G 11: 45,906,177 probably null Het
Col6a3 A G 1: 90,779,059 Y2111H unknown Het
Csnk1g1 A G 9: 66,019,915 probably null Het
Dse A T 10: 34,153,149 N648K probably damaging Het
Dsp A G 13: 38,192,990 K1584E probably benign Het
Ezh2 A T 6: 47,576,660 M41K probably damaging Het
Fam71e2 A G 7: 4,758,154 S520P probably damaging Het
Fscn2 G A 11: 120,368,026 G466S probably damaging Het
Gm15217 A G 14: 46,383,206 probably benign Het
Gm9696 T C 3: 59,972,275 noncoding transcript Het
Gosr2 G A 11: 103,679,250 Q162* probably null Het
Hectd4 T A 5: 121,349,530 H3529Q possibly damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2c A T 5: 25,290,527 I4074K probably damaging Het
Map3k11 A G 19: 5,697,401 D555G probably benign Het
Mindy2 A G 9: 70,631,030 I341T probably damaging Het
Mrnip G A 11: 50,176,891 probably null Het
Muc5b G A 7: 141,859,107 C1930Y unknown Het
Nfatc3 T G 8: 106,078,850 I109S probably damaging Het
Npas1 G T 7: 16,474,616 A112D probably benign Het
Npffr2 T A 5: 89,568,066 I84N probably damaging Het
Nxph4 T A 10: 127,526,596 H142L probably damaging Het
Otud4 T A 8: 79,651,665 probably benign Het
Per3 A G 4: 151,009,248 probably null Het
Pigr G A 1: 130,841,803 R117Q possibly damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prex2 T A 1: 11,089,884 probably benign Het
Sall4 G A 2: 168,752,635 P420L probably benign Het
Sap30bp A G 11: 115,964,220 K252R probably damaging Het
Sec63 T A 10: 42,827,918 Y692* probably null Het
Sema3e C T 5: 14,210,376 T181M probably damaging Het
Sf3b3 T C 8: 110,813,832 I986V probably benign Het
Shisa4 A T 1: 135,371,962 Y194* probably null Het
Slc17a6 G A 7: 51,661,585 probably benign Het
Smg1 T G 7: 118,165,967 probably null Het
Smim7 C T 8: 72,571,005 G9R probably damaging Het
Spata31d1d C T 13: 59,726,497 G1075R probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stag3 T C 5: 138,304,509 probably benign Het
Tbce A G 13: 14,009,642 I217T possibly damaging Het
Tpk1 G A 6: 43,611,350 P27S probably benign Het
Tsc22d1 A G 14: 76,418,357 I2V probably benign Het
Uchl1 T C 5: 66,677,074 probably null Het
Ugt2b38 T A 5: 87,423,633 Q180L probably benign Het
Other mutations in Tulp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Tulp4 APN 17 6139076 missense probably damaging 0.97
IGL02503:Tulp4 APN 17 6213391 missense probably damaging 0.99
IGL03012:Tulp4 APN 17 6213379 splice site probably benign
IGL03219:Tulp4 APN 17 6139010 missense probably damaging 1.00
tuba_mirum UTSW 17 6201819 missense probably damaging 1.00
R0066:Tulp4 UTSW 17 6201733 missense probably damaging 0.99
R0066:Tulp4 UTSW 17 6201733 missense probably damaging 0.99
R0711:Tulp4 UTSW 17 6139112 missense possibly damaging 0.94
R1718:Tulp4 UTSW 17 6222440 missense probably benign 0.39
R1775:Tulp4 UTSW 17 6139046 missense probably damaging 0.96
R1793:Tulp4 UTSW 17 6139112 missense possibly damaging 0.94
R3160:Tulp4 UTSW 17 6198708 start codon destroyed probably null 0.94
R3162:Tulp4 UTSW 17 6198708 start codon destroyed probably null 0.94
R3431:Tulp4 UTSW 17 6206964 missense probably benign 0.03
R4081:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R4082:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R4610:Tulp4 UTSW 17 6198833 missense probably damaging 0.96
R4963:Tulp4 UTSW 17 6198813 missense probably damaging 1.00
R4966:Tulp4 UTSW 17 6198813 missense probably damaging 1.00
R5386:Tulp4 UTSW 17 6236293 missense probably damaging 1.00
R6019:Tulp4 UTSW 17 6233215 missense possibly damaging 0.66
R6275:Tulp4 UTSW 17 6198736 missense probably damaging 1.00
R6294:Tulp4 UTSW 17 6201819 missense probably damaging 1.00
R6587:Tulp4 UTSW 17 6231871 missense possibly damaging 0.62
R6680:Tulp4 UTSW 17 6139037 missense probably damaging 1.00
R7030:Tulp4 UTSW 17 6214666 missense probably damaging 1.00
R7068:Tulp4 UTSW 17 6185289 missense probably damaging 1.00
R7109:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7110:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7229:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7230:Tulp4 UTSW 17 6231780 missense probably damaging 1.00
R7231:Tulp4 UTSW 17 6236235 missense probably benign 0.03
R7438:Tulp4 UTSW 17 6198708 missense probably benign 0.42
R7750:Tulp4 UTSW 17 6233124 missense probably damaging 1.00
X0067:Tulp4 UTSW 17 6206923 missense possibly damaging 0.93
Z1177:Tulp4 UTSW 17 6224205 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ACCTCCCGTGATCGTACTGACTATG -3'
(R):5'- TGGCTGAAGTACCACAGCAGACTC -3'

Sequencing Primer
(F):5'- CGTGATCGTACTGACTATGTCAAC -3'
(R):5'- AGCAGACTCCTGTTGTGC -3'
Posted On2014-05-23