Incidental Mutation 'R1736:Map3k11'
ID199749
Institutional Source Beutler Lab
Gene Symbol Map3k11
Ensembl Gene ENSMUSG00000004054
Gene Namemitogen-activated protein kinase kinase kinase 11
SynonymsMlk3, 2610017K16Rik
MMRRC Submission 039768-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.580) question?
Stock #R1736 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5689131-5702862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5697401 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 555 (D555G)
Ref Sequence ENSEMBL: ENSMUSP00000004156 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004156]
Predicted Effect probably benign
Transcript: ENSMUST00000004156
AA Change: D555G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000004156
Gene: ENSMUSG00000004054
AA Change: D555G

DomainStartEndE-ValueType
low complexity region 11 36 N/A INTRINSIC
SH3 45 105 6.79e-19 SMART
TyrKc 118 377 6.83e-81 SMART
coiled coil region 398 444 N/A INTRINSIC
low complexity region 467 476 N/A INTRINSIC
low complexity region 593 610 N/A INTRINSIC
low complexity region 614 632 N/A INTRINSIC
low complexity region 676 697 N/A INTRINSIC
low complexity region 759 778 N/A INTRINSIC
low complexity region 786 805 N/A INTRINSIC
low complexity region 809 820 N/A INTRINSIC
Meta Mutation Damage Score 0.0910 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.2%
  • 20x: 92.0%
Validation Efficiency 97% (57/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serine/threonine kinase family. This kinase contains a SH3 domain and a leucine zipper-basic motif. This kinase preferentially activates MAPK8/JNK kinase, and functions as a positive regulator of JNK signaling pathway. This kinase can directly phosphorylate, and activates IkappaB kinase alpha and beta, and is found to be involved in the transcription activity of NF-kappaB mediated by Rho family GTPases and CDC42. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted or spontaneous mutation display a pattern of dark red stripes of thin dorsal epithelium during pre-wean development, and necrotic dental pulp has been reported for the spontaneous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Adcy3 A G 12: 4,200,998 N586D possibly damaging Het
Ak6 T A 13: 100,655,181 probably null Het
Ankrd66 T C 17: 43,543,518 D41G probably benign Het
Atp8b2 G A 3: 89,952,694 P339S probably damaging Het
BC025446 G A 15: 75,217,720 G26R probably damaging Het
Cacna1d C T 14: 30,089,863 V1297I probably damaging Het
Cbl A T 9: 44,152,895 D781E possibly damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Clint1 A G 11: 45,906,177 probably null Het
Col6a3 A G 1: 90,779,059 Y2111H unknown Het
Csnk1g1 A G 9: 66,019,915 probably null Het
Dse A T 10: 34,153,149 N648K probably damaging Het
Dsp A G 13: 38,192,990 K1584E probably benign Het
Ezh2 A T 6: 47,576,660 M41K probably damaging Het
Fam71e2 A G 7: 4,758,154 S520P probably damaging Het
Fscn2 G A 11: 120,368,026 G466S probably damaging Het
Gm15217 A G 14: 46,383,206 probably benign Het
Gm9696 T C 3: 59,972,275 noncoding transcript Het
Gosr2 G A 11: 103,679,250 Q162* probably null Het
Hectd4 T A 5: 121,349,530 H3529Q possibly damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Kmt2c A T 5: 25,290,527 I4074K probably damaging Het
Mindy2 A G 9: 70,631,030 I341T probably damaging Het
Mrnip G A 11: 50,176,891 probably null Het
Muc5b G A 7: 141,859,107 C1930Y unknown Het
Nfatc3 T G 8: 106,078,850 I109S probably damaging Het
Npas1 G T 7: 16,474,616 A112D probably benign Het
Npffr2 T A 5: 89,568,066 I84N probably damaging Het
Nxph4 T A 10: 127,526,596 H142L probably damaging Het
Otud4 T A 8: 79,651,665 probably benign Het
Per3 A G 4: 151,009,248 probably null Het
Pigr G A 1: 130,841,803 R117Q possibly damaging Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Prex2 T A 1: 11,089,884 probably benign Het
Sall4 G A 2: 168,752,635 P420L probably benign Het
Sap30bp A G 11: 115,964,220 K252R probably damaging Het
Sec63 T A 10: 42,827,918 Y692* probably null Het
Sema3e C T 5: 14,210,376 T181M probably damaging Het
Sf3b3 T C 8: 110,813,832 I986V probably benign Het
Shisa4 A T 1: 135,371,962 Y194* probably null Het
Slc17a6 G A 7: 51,661,585 probably benign Het
Smg1 T G 7: 118,165,967 probably null Het
Smim7 C T 8: 72,571,005 G9R probably damaging Het
Spata31d1d C T 13: 59,726,497 G1075R probably benign Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Stag3 T C 5: 138,304,509 probably benign Het
Tbce A G 13: 14,009,642 I217T possibly damaging Het
Tpk1 G A 6: 43,611,350 P27S probably benign Het
Tsc22d1 A G 14: 76,418,357 I2V probably benign Het
Tulp4 T G 17: 6,233,215 V1173G possibly damaging Het
Uchl1 T C 5: 66,677,074 probably null Het
Ugt2b38 T A 5: 87,423,633 Q180L probably benign Het
Other mutations in Map3k11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02017:Map3k11 APN 19 5697623 missense possibly damaging 0.91
IGL02581:Map3k11 APN 19 5700806 missense probably benign
R0130:Map3k11 UTSW 19 5690815 missense probably damaging 1.00
R0193:Map3k11 UTSW 19 5695846 missense probably damaging 0.99
R1621:Map3k11 UTSW 19 5690806 missense probably damaging 1.00
R1791:Map3k11 UTSW 19 5695572 nonsense probably null
R3500:Map3k11 UTSW 19 5690247 start codon destroyed probably benign 0.08
R3836:Map3k11 UTSW 19 5690803 missense possibly damaging 0.71
R3892:Map3k11 UTSW 19 5702283 missense probably benign 0.13
R4303:Map3k11 UTSW 19 5690824 missense probably damaging 1.00
R4513:Map3k11 UTSW 19 5702210 missense probably damaging 0.97
R4613:Map3k11 UTSW 19 5697470 missense probably benign 0.18
R4613:Map3k11 UTSW 19 5697471 missense probably damaging 0.98
R4631:Map3k11 UTSW 19 5690913 missense probably benign 0.30
R4780:Map3k11 UTSW 19 5690938 missense probably damaging 0.99
R5213:Map3k11 UTSW 19 5690641 missense probably damaging 0.99
R5266:Map3k11 UTSW 19 5700594 missense probably benign 0.03
R5372:Map3k11 UTSW 19 5690962 missense probably damaging 1.00
R5736:Map3k11 UTSW 19 5696711 missense probably damaging 1.00
R5899:Map3k11 UTSW 19 5695909 critical splice donor site probably null
R6052:Map3k11 UTSW 19 5697402 missense probably benign 0.01
R6388:Map3k11 UTSW 19 5690251 missense probably damaging 0.96
R6623:Map3k11 UTSW 19 5695603 missense probably damaging 0.97
R6975:Map3k11 UTSW 19 5690727 missense possibly damaging 0.91
R7309:Map3k11 UTSW 19 5690458 missense probably damaging 0.99
R7771:Map3k11 UTSW 19 5690608 missense probably damaging 0.99
R7815:Map3k11 UTSW 19 5695639 missense possibly damaging 0.89
X0025:Map3k11 UTSW 19 5696195 frame shift probably null
Predicted Primers PCR Primer
(F):5'- ATGGATCGGCCTTTTGACCATACC -3'
(R):5'- GTCTCCTGGAAAGGGAACATGCTTG -3'

Sequencing Primer
(F):5'- ggtcgtttctttgtagccttg -3'
(R):5'- CTCTAAAGAGTAGAACGCCAGG -3'
Posted On2014-05-23