Mutagenetix > Incidental Mutation

Incidental Mutation 'R0087:Thbs4'

19976

Institutional Source

Beutler Lab

Gene Symbol

Thbs4

Ensembl Gene

ENSMUSG00000021702

Gene Name

thrombospondin 4

Synonyms

TSP-4, TSP4

MMRRC Submission

038374-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0087 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

92751590-92794818 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 92755235 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 791 (T791S)

Ref Sequence

ENSEMBL: ENSMUSP00000022213 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022213]

AlphaFold

Q9Z1T2

Predicted Effect

probably damaging
Transcript: ENSMUST00000022213
AA Change: T791S

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000022213
Gene: ENSMUSG00000021702
AA Change: T791S

Domain	Start	End	E-Value	Type
low complexity region	6	18	N/A	INTRINSIC
TSPN	26	194	1.66e-51	SMART
Pfam:COMP	220	264	1.2e-24	PFAM
low complexity region	280	290	N/A	INTRINSIC
EGF	291	327	1.04e-3	SMART
EGF_CA	328	380	7.29e-8	SMART
EGF_CA	381	421	1.42e-10	SMART
EGF	425	464	4.32e-1	SMART
Pfam:TSP_3	498	533	7.1e-15	PFAM
Pfam:TSP_3	557	592	7.8e-17	PFAM
Pfam:TSP_3	616	653	1.4e-11	PFAM
Pfam:TSP_3	654	693	1.3e-10	PFAM
Pfam:TSP_3	694	729	1e-14	PFAM
Pfam:TSP_C	747	944	3.8e-102	PFAM

Meta Mutation Damage Score

0.7168

Coding Region Coverage

1x: 98.8%
3x: 97.6%
10x: 93.5%
20x: 82.3%

Validation Efficiency

86% (59/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the thrombospondin protein family. Thrombospondin family members are adhesive glycoproteins that mediate cell-to-cell and cell-to-matrix interactions. This protein forms a pentamer and can bind to heparin and calcium. It is involved in local signaling in the developing and adult nervous system, and it contributes to spinal sensitization and neuropathic pain states. This gene is activated during the stromal response to invasive breast cancer. It may also play a role in inflammatory responses in Alzheimer's disease. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to cardiac pressure overload, including increased hypertrophy, decreased ejection fraction, decreased microvessle number, increased extracellular matrix deposition and increased fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Add3	T	A	19: 53,226,607	L71Q	probably damaging	Het
Adgrv1	T	A	13: 81,386,951	I5732F	probably damaging	Het
Adss	A	T	1: 177,771,222	V330E	probably benign	Het
Agps	T	A	2: 75,909,635	Y488N	probably damaging	Het
Ap3s1	A	T	18: 46,758,039	R66S	probably damaging	Het
Ass1	A	T	2: 31,514,819	N371Y	probably damaging	Het
Atp2a2	C	T	5: 122,460,961	V593I	probably benign	Het
Chrna6	C	T	8: 27,406,986	V288M	probably damaging	Het
Col4a2	C	T	8: 11,441,296	L1232F	probably benign	Het
Dcaf1	A	G	9: 106,863,089	N1225D	probably damaging	Het
Degs1	A	G	1: 182,279,310	I128T	probably benign	Het
Dnah5	A	T	15: 28,350,613	T2594S	probably damaging	Het
Dnah8	G	T	17: 30,755,119	R2826L	probably damaging	Het
Elf3	A	G	1: 135,257,137	Y104H	probably damaging	Het
Fam222b	C	A	11: 78,153,892	T93N	probably benign	Het
Fbxw26	A	G	9: 109,724,938	I211T	probably benign	Het
Fcho2	T	C	13: 98,735,086	T541A	probably benign	Het
Flg2	T	C	3: 93,202,431	S589P	unknown	Het
Foxj3	T	A	4: 119,626,400	V589E	unknown	Het
Gria1	A	G	11: 57,317,712	Y742C	probably damaging	Het
Inpp5d	T	C	1: 87,715,138	S672P	probably damaging	Het
Lrrc19	A	C	4: 94,640,772	F91C	probably damaging	Het
Lrrc6	T	C	15: 66,469,975	T91A	probably benign	Het
Mppe1	A	G	18: 67,225,704	*398R	probably null	Het
Mroh3	T	C	1: 136,190,803	I561V	probably benign	Het
Myh11	C	A	16: 14,224,019	Q720H	probably damaging	Het
Nbea	G	T	3: 56,091,023	T121K	possibly damaging	Het
Nbr1	A	C	11: 101,564,693	D91A	probably benign	Het
Ncam2	C	A	16: 81,434,901	N84K	probably benign	Het
Olfr1260	T	C	2: 89,978,131	Y118H	probably damaging	Het
Olfr616	A	T	7: 103,564,362	C306S	probably benign	Het
Olfr618	A	G	7: 103,597,721	Y135C	probably benign	Het
Olfr651	A	G	7: 104,553,662	I248V	possibly damaging	Het
Olfr711	A	G	7: 106,972,116	V76A	probably benign	Het
Pdgfrb	A	T	18: 61,061,513	I121F	probably damaging	Het
Peak1	A	T	9: 56,258,325	I773N	probably damaging	Het
Pfkfb4	G	T	9: 109,007,701	V155F	probably damaging	Het
Pkm	C	T	9: 59,678,099	R455*	probably null	Het
Plbd2	C	A	5: 120,494,485	E151*	probably null	Het
Pld5	G	A	1: 175,984,459	T353M	probably damaging	Het
Psme2b	A	T	11: 48,945,717	D134E	possibly damaging	Het
Rida	T	A	15: 34,488,626	D40V	possibly damaging	Het
Rnf126	A	T	10: 79,759,234	H265Q	probably damaging	Het
Rock2	C	A	12: 16,928,966	Q86K	probably benign	Het
Serpinb1b	A	T	13: 33,085,319	T12S	probably benign	Het
Slco6c1	T	A	1: 97,118,578	Q277L	probably benign	Het
Sptlc2	T	A	12: 87,369,118	H45L	probably benign	Het
Srsf4	A	G	4: 131,900,330		probably benign	Het
Sspo	A	G	6: 48,477,785	S2969G	probably damaging	Het
Steap1	C	T	5: 5,736,664	G258R	probably damaging	Het
Stk19	A	T	17: 34,836,875	M1K	probably null	Het
Stk-ps2	C	A	1: 46,029,889		noncoding transcript	Het
Taf1c	C	T	8: 119,600,987	R332H	probably damaging	Het
Theg	A	T	10: 79,585,951	Y144*	probably null	Het
Tjap1	A	G	17: 46,263,726	L21P	probably damaging	Het
Tmem145	A	G	7: 25,307,843	Y148C	probably damaging	Het
Tmem267	T	A	13: 119,609,274	V155E	probably benign	Het
Tns1	T	A	1: 73,916,917	H549L	possibly damaging	Het
Tyro3	T	G	2: 119,801,701	I83S	probably benign	Het
Ubxn4	G	A	1: 128,262,904	E256K	probably benign	Het
Vmn1r53	A	T	6: 90,223,431	C304S	probably benign	Het
Vwf	G	A	6: 125,645,954	M1761I	probably benign	Het
Zfp276	T	C	8: 123,265,047	Y445H	probably damaging	Het
Zfp407	A	T	18: 84,560,411	I859N	probably damaging	Het

Other mutations in Thbs4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Thbs4	APN	13	92776980	missense	probably benign	0.04
IGL02318:Thbs4	APN	13	92763584	missense	probably damaging	1.00
IGL02887:Thbs4	APN	13	92790798	missense	probably benign	0.00
IGL03205:Thbs4	APN	13	92762774	missense	probably damaging	1.00
IGL03382:Thbs4	APN	13	92769548	missense	probably benign	0.37
R0128:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0130:Thbs4	UTSW	13	92754410	missense	probably benign	0.00
R0276:Thbs4	UTSW	13	92775532	missense	probably benign	0.00
R0423:Thbs4	UTSW	13	92756571	missense	probably damaging	0.99
R0504:Thbs4	UTSW	13	92767184	missense	probably benign	0.04
R0708:Thbs4	UTSW	13	92773186	missense	probably damaging	1.00
R0836:Thbs4	UTSW	13	92758038	missense	probably damaging	1.00
R1078:Thbs4	UTSW	13	92762926	splice site	probably benign
R1139:Thbs4	UTSW	13	92774718	missense	probably damaging	1.00
R1253:Thbs4	UTSW	13	92776905	missense	probably benign	0.17
R1342:Thbs4	UTSW	13	92752417	missense	probably damaging	1.00
R1416:Thbs4	UTSW	13	92761533	missense	probably benign
R1834:Thbs4	UTSW	13	92761481	missense	probably benign	0.00
R1950:Thbs4	UTSW	13	92769571	missense	probably damaging	0.99
R2056:Thbs4	UTSW	13	92790879	missense	probably benign	0.00
R2184:Thbs4	UTSW	13	92774794	missense	probably benign
R2198:Thbs4	UTSW	13	92763271	missense	possibly damaging	0.78
R2859:Thbs4	UTSW	13	92790708	missense	probably benign	0.02
R3605:Thbs4	UTSW	13	92757959	nonsense	probably null
R3783:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3784:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3786:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R3787:Thbs4	UTSW	13	92773164	missense	probably benign	0.09
R4061:Thbs4	UTSW	13	92776097	critical splice donor site	probably null
R4790:Thbs4	UTSW	13	92762806	missense	probably damaging	1.00
R4968:Thbs4	UTSW	13	92758068	missense	possibly damaging	0.55
R4983:Thbs4	UTSW	13	92790699	missense	probably benign	0.29
R5185:Thbs4	UTSW	13	92775167	missense	probably damaging	0.97
R5352:Thbs4	UTSW	13	92763590	missense	probably damaging	1.00
R5361:Thbs4	UTSW	13	92776993	missense	probably benign
R5589:Thbs4	UTSW	13	92776074	splice site	probably null
R5700:Thbs4	UTSW	13	92776953	missense	probably benign	0.00
R6061:Thbs4	UTSW	13	92751795	missense	probably benign	0.00
R6101:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6105:Thbs4	UTSW	13	92775485	missense	possibly damaging	0.90
R6227:Thbs4	UTSW	13	92774682	missense	probably null	1.00
R6249:Thbs4	UTSW	13	92774707	missense	probably damaging	1.00
R6651:Thbs4	UTSW	13	92756536	missense	probably benign	0.06
R6735:Thbs4	UTSW	13	92755166	missense	possibly damaging	0.71
R6885:Thbs4	UTSW	13	92762869	missense	probably damaging	0.96
R6913:Thbs4	UTSW	13	92757936	missense	possibly damaging	0.94
R7409:Thbs4	UTSW	13	92773259	nonsense	probably null
R7480:Thbs4	UTSW	13	92767221	missense	probably benign	0.00
R7682:Thbs4	UTSW	13	92775562	missense	probably benign	0.21
R8022:Thbs4	UTSW	13	92752447	missense	probably damaging	1.00
R8213:Thbs4	UTSW	13	92760586	critical splice acceptor site	probably null
R8231:Thbs4	UTSW	13	92774844	missense	probably benign
R8353:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8445:Thbs4	UTSW	13	92790841	missense	probably benign	0.00
R8453:Thbs4	UTSW	13	92790817	missense	probably benign	0.04
R8520:Thbs4	UTSW	13	92754284	nonsense	probably null
R8560:Thbs4	UTSW	13	92755100	missense	probably damaging	0.97
R8774:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R8774-TAIL:Thbs4	UTSW	13	92761522	missense	probably damaging	1.00
R9061:Thbs4	UTSW	13	92774679	critical splice donor site	probably null
R9223:Thbs4	UTSW	13	92761490	missense	probably damaging	1.00
R9653:Thbs4	UTSW	13	92761514	missense	probably benign
R9691:Thbs4	UTSW	13	92754388	missense	probably damaging	1.00
R9778:Thbs4	UTSW	13	92776987	missense	probably benign	0.17
Z1177:Thbs4	UTSW	13	92754376	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCATAGGTTGAAAGGTGCAGGCTC -3'
(R):5'- TGTGCAGACCATGAACAGTGACCC -3'

Sequencing Primer
(F):5'- AAGGTTGTCGCTCAAGGCTC -3'
(R):5'- ACCCTGGCCTAGCTGTTG -3'

Posted On

2013-04-11