Incidental Mutation 'R1737:Oca2'
ID199780
Institutional Source Beutler Lab
Gene Symbol Oca2
Ensembl Gene ENSMUSG00000030450
Gene Nameoculocutaneous albinism II
SynonymsD7H15S12, p, D7H15S12
MMRRC Submission 039769-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1737 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location56239760-56536518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56328785 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 567 (R567H)
Ref Sequence ENSEMBL: ENSMUSP00000032633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032633] [ENSMUST00000144739] [ENSMUST00000152693]
Predicted Effect probably damaging
Transcript: ENSMUST00000032633
AA Change: R567H

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032633
Gene: ENSMUSG00000030450
AA Change: R567H

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ArsB 319 558 2e-10 PFAM
Pfam:CitMHS 337 770 2e-49 PFAM
Pfam:ArsB 562 827 8.9e-9 PFAM
Pfam:Na_sulph_symp 573 832 6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144739
Predicted Effect probably benign
Transcript: ENSMUST00000152693
SMART Domains Protein: ENSMUSP00000119099
Gene: ENSMUSG00000030450

DomainStartEndE-ValueType
transmembrane domain 171 193 N/A INTRINSIC
Meta Mutation Damage Score 0.2840 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.4%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the human homolog of the mouse p (pink-eyed dilution) gene. The encoded protein is believed to be an integral membrane protein involved in small molecule transport, specifically tyrosine, which is a precursor to melanin synthesis. It is involved in mammalian pigmentation, where it may control skin color variation and act as a determinant of brown or blue eye color. Mutations in this gene result in type 2 oculocutaneous albinism. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mutations generally result in varying degrees of coat and eye pigment dilution. Specific alleles produce cleft palate, reproductive, endocrine or neurological disorders, and/or lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Ak7 G A 12: 105,742,332 V349M probably damaging Het
Aldh1a2 A T 9: 71,285,171 E436V possibly damaging Het
Apc C A 18: 34,317,022 P2290T probably damaging Het
Atp10a T C 7: 58,827,238 probably benign Het
Bahd1 T C 2: 118,915,923 S8P probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Capn10 T C 1: 92,934,955 Y28H probably benign Het
Ccdc129 A T 6: 55,968,304 D670V probably damaging Het
Cdh10 A T 15: 18,964,063 I104F probably damaging Het
Cep170b A G 12: 112,736,627 D508G possibly damaging Het
Ces2a G T 8: 104,740,824 A494S probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cltc G A 11: 86,733,727 T123M probably damaging Het
Cnot1 A G 8: 95,748,276 S1102P probably damaging Het
Col12a1 C A 9: 79,703,451 D224Y probably damaging Het
Col14a1 T A 15: 55,344,961 probably benign Het
Cyp7a1 T A 4: 6,272,848 T122S probably benign Het
Dock4 A G 12: 40,807,001 probably null Het
Eid2 T C 7: 28,268,499 V182A possibly damaging Het
Eloa A T 4: 136,010,770 V293D probably benign Het
Enkur G A 2: 21,194,295 P143S probably damaging Het
Ep300 T C 15: 81,626,347 Y99H probably damaging Het
Fbxw5 C A 2: 25,503,584 L66I probably benign Het
Flg2 A T 3: 93,203,621 R985S unknown Het
Fscb A T 12: 64,474,581 I37K possibly damaging Het
H2-M10.3 T C 17: 36,368,404 N3S probably benign Het
H2-Q7 A C 17: 35,439,626 Y80S probably damaging Het
H60c A T 10: 3,259,914 D124E possibly damaging Het
Hsd3b2 A T 3: 98,711,546 V361E probably damaging Het
Ice1 A C 13: 70,606,325 C547W probably damaging Het
Jmy A G 13: 93,498,795 V171A probably damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Klk1b1 A T 7: 43,970,359 Q114L probably benign Het
Krt10 A G 11: 99,387,387 M280T possibly damaging Het
Lama1 G A 17: 67,802,921 R2179Q probably benign Het
Mbd3l1 C T 9: 18,484,929 P117S possibly damaging Het
Med18 A T 4: 132,460,109 S71R probably damaging Het
Mov10l1 T A 15: 89,011,404 I643N possibly damaging Het
Nfib T C 4: 82,498,589 K70E probably damaging Het
Nr3c2 A C 8: 76,908,329 S20R probably benign Het
Nr6a1 A T 2: 38,738,943 F356L probably benign Het
Olfr370 A G 8: 83,541,416 S91G probably benign Het
Olfr395 T A 11: 73,907,085 M136L possibly damaging Het
Olfr59 T C 11: 74,288,811 L55P probably damaging Het
Olfr794 T A 10: 129,570,828 Y58N probably damaging Het
Olfr952 T C 9: 39,426,958 T38A probably damaging Het
Pcdhb10 A G 18: 37,412,956 T362A probably benign Het
Pip5k1b A T 19: 24,397,040 V59E probably damaging Het
Pkhd1l1 G A 15: 44,547,509 probably null Het
Prr36 T C 8: 4,214,370 probably benign Het
Ptger2 A G 14: 45,001,771 T289A probably benign Het
Rad18 A G 6: 112,681,537 F136L probably damaging Het
Rhbg T A 3: 88,245,874 S258C probably damaging Het
Scgb2b27 T C 7: 34,013,314 I34M possibly damaging Het
Senp7 C A 16: 56,123,799 T135K probably damaging Het
Slc20a2 A G 8: 22,545,566 I193M probably damaging Het
Slc27a1 G A 8: 71,570,860 V47I probably benign Het
Slc9a5 G A 8: 105,368,134 V786M probably damaging Het
Smyd1 A G 6: 71,216,891 L350P probably damaging Het
Ston2 A T 12: 91,647,907 F576I probably damaging Het
Sulf2 A T 2: 166,082,678 V496E probably benign Het
Tcl1b3 C A 12: 105,191,222 S41Y probably damaging Het
Tulp2 A T 7: 45,519,777 N256I probably damaging Het
Uspl1 T A 5: 149,201,858 C349S probably damaging Het
Vcl T C 14: 21,020,536 I730T probably damaging Het
Vmn1r61 A T 7: 5,611,061 F85I probably benign Het
Zfp318 A G 17: 46,399,477 T709A probably benign Het
Zfr2 T C 10: 81,242,085 S249P probably damaging Het
Other mutations in Oca2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Oca2 APN 7 56280846 missense probably damaging 0.99
IGL01022:Oca2 APN 7 56324756 missense probably damaging 1.00
IGL01666:Oca2 APN 7 56314811 splice site probably null
IGL02157:Oca2 APN 7 56324797 splice site probably null
IGL02213:Oca2 APN 7 56321484 splice site probably benign
IGL02314:Oca2 APN 7 56357151 missense probably benign 0.00
IGL03083:Oca2 APN 7 56295484 missense probably benign 0.28
IGL03356:Oca2 APN 7 56535968 missense probably benign 0.01
charbon UTSW 7 56316405 missense probably damaging 1.00
cotton UTSW 7 56535968 missense probably benign 0.00
Dirk UTSW 7 56535968 missense probably benign 0.00
draco1 UTSW 7 56423352 missense probably benign 0.00
faded UTSW 7 56324661 missense probably benign 0.19
hardy UTSW 7 56295460 missense probably damaging 1.00
narwhal UTSW 7 56295498 nonsense probably null
quicksilver UTSW 7 56324661 missense probably benign 0.19
renesmee UTSW 7 56535968 missense probably benign 0.00
snowflake UTSW 7 56324680 missense probably damaging 1.00
whitemouse UTSW 7 56414431 missense probably damaging 1.00
R0440:Oca2 UTSW 7 56423352 missense probably benign 0.00
R1067:Oca2 UTSW 7 56316393 missense probably damaging 1.00
R1349:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1372:Oca2 UTSW 7 56535968 missense probably benign 0.00
R1457:Oca2 UTSW 7 56321521 missense probably damaging 1.00
R1802:Oca2 UTSW 7 56254980 missense possibly damaging 0.96
R1957:Oca2 UTSW 7 56321498 missense possibly damaging 0.82
R1966:Oca2 UTSW 7 56414467 missense probably damaging 0.99
R2082:Oca2 UTSW 7 56297137 missense probably benign 0.01
R2229:Oca2 UTSW 7 56357155 missense probably benign 0.11
R4120:Oca2 UTSW 7 56254882 missense probably damaging 1.00
R4192:Oca2 UTSW 7 56297249 missense probably damaging 1.00
R4405:Oca2 UTSW 7 56414434 missense possibly damaging 0.63
R4654:Oca2 UTSW 7 56328812 missense probably benign 0.44
R4701:Oca2 UTSW 7 56255002 missense probably benign 0.00
R4887:Oca2 UTSW 7 56330358 nonsense probably null
R5053:Oca2 UTSW 7 56323580 missense probably benign 0.02
R5215:Oca2 UTSW 7 56295498 nonsense probably null
R5430:Oca2 UTSW 7 56295460 missense probably damaging 1.00
R5677:Oca2 UTSW 7 56414462 missense probably damaging 1.00
R6416:Oca2 UTSW 7 56328767 missense probably benign 0.44
R6645:Oca2 UTSW 7 56314774 missense probably benign 0.21
R7257:Oca2 UTSW 7 56279538 intron probably benign
R7409:Oca2 UTSW 7 56414397 missense probably benign 0.00
R7530:Oca2 UTSW 7 56331972 missense probably damaging 0.99
R7820:Oca2 UTSW 7 56331965 missense probably damaging 1.00
Z1088:Oca2 UTSW 7 56330375 missense probably null 0.83
Predicted Primers PCR Primer
(F):5'- AGCATCTGAGAAGCTGTGACAAACC -3'
(R):5'- GTTCCTTCATGCAATGCCACCG -3'

Sequencing Primer
(F):5'- CCACGATGACTTTCAGAGTTCAG -3'
(R):5'- TTCATGCAATGCCACCGTTAAG -3'
Posted On2014-05-23