Incidental Mutation 'R1737:Nr3c2'
ID199786
Institutional Source Beutler Lab
Gene Symbol Nr3c2
Ensembl Gene ENSMUSG00000031618
Gene Namenuclear receptor subfamily 3, group C, member 2
SynonymsMR, aldosterone receptor, mineralocorticoid receptor, Mlr
MMRRC Submission 039769-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1737 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location76899442-77245012 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 76908329 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 20 (S20R)
Ref Sequence ENSEMBL: ENSMUSP00000116008 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034031] [ENSMUST00000109911] [ENSMUST00000109912] [ENSMUST00000109913] [ENSMUST00000128862] [ENSMUST00000143284] [ENSMUST00000148106]
Predicted Effect probably benign
Transcript: ENSMUST00000034031
AA Change: S20R

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000034031
Gene: ENSMUSG00000031618
AA Change: S20R

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 675 1.89e-31 SMART
low complexity region 690 706 N/A INTRINSIC
HOLI 771 935 7.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109911
AA Change: S20R

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105537
Gene: ENSMUSG00000031618
AA Change: S20R

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
HOLI 658 818 1.1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109912
AA Change: S20R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105538
Gene: ENSMUSG00000031618
AA Change: S20R

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109913
AA Change: S20R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105539
Gene: ENSMUSG00000031618
AA Change: S20R

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
low complexity region 686 702 N/A INTRINSIC
HOLI 767 931 7.78e-33 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128862
AA Change: S20R

PolyPhen 2 Score 0.162 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000143284
AA Change: S20R

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000148106
AA Change: S20R

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118222
Gene: ENSMUSG00000031618
AA Change: S20R

DomainStartEndE-ValueType
low complexity region 212 222 N/A INTRINSIC
low complexity region 259 277 N/A INTRINSIC
low complexity region 280 300 N/A INTRINSIC
low complexity region 346 354 N/A INTRINSIC
low complexity region 584 598 N/A INTRINSIC
ZnF_C4 600 671 5.29e-35 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.4%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mineralocorticoid receptor, which mediates aldosterone actions on salt and water balance within restricted target cells. The protein functions as a ligand-dependent transcription factor that binds to mineralocorticoid response elements in order to transactivate target genes. Mutations in this gene cause autosomal dominant pseudohypoaldosteronism type I, a disorder characterized by urinary salt wasting. Defects in this gene are also associated with early onset hypertension with severe exacerbation in pregnancy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit weight loss and symptoms of pseudohypoaldosteronism, and eventually die at around day 10 after birth from renal salt wasting and dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Ak7 G A 12: 105,742,332 V349M probably damaging Het
Aldh1a2 A T 9: 71,285,171 E436V possibly damaging Het
Apc C A 18: 34,317,022 P2290T probably damaging Het
Atp10a T C 7: 58,827,238 probably benign Het
Bahd1 T C 2: 118,915,923 S8P probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Capn10 T C 1: 92,934,955 Y28H probably benign Het
Ccdc129 A T 6: 55,968,304 D670V probably damaging Het
Cdh10 A T 15: 18,964,063 I104F probably damaging Het
Cep170b A G 12: 112,736,627 D508G possibly damaging Het
Ces2a G T 8: 104,740,824 A494S probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cltc G A 11: 86,733,727 T123M probably damaging Het
Cnot1 A G 8: 95,748,276 S1102P probably damaging Het
Col12a1 C A 9: 79,703,451 D224Y probably damaging Het
Col14a1 T A 15: 55,344,961 probably benign Het
Cyp7a1 T A 4: 6,272,848 T122S probably benign Het
Dock4 A G 12: 40,807,001 probably null Het
Eid2 T C 7: 28,268,499 V182A possibly damaging Het
Eloa A T 4: 136,010,770 V293D probably benign Het
Enkur G A 2: 21,194,295 P143S probably damaging Het
Ep300 T C 15: 81,626,347 Y99H probably damaging Het
Fbxw5 C A 2: 25,503,584 L66I probably benign Het
Flg2 A T 3: 93,203,621 R985S unknown Het
Fscb A T 12: 64,474,581 I37K possibly damaging Het
H2-M10.3 T C 17: 36,368,404 N3S probably benign Het
H2-Q7 A C 17: 35,439,626 Y80S probably damaging Het
H60c A T 10: 3,259,914 D124E possibly damaging Het
Hsd3b2 A T 3: 98,711,546 V361E probably damaging Het
Ice1 A C 13: 70,606,325 C547W probably damaging Het
Jmy A G 13: 93,498,795 V171A probably damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Klk1b1 A T 7: 43,970,359 Q114L probably benign Het
Krt10 A G 11: 99,387,387 M280T possibly damaging Het
Lama1 G A 17: 67,802,921 R2179Q probably benign Het
Mbd3l1 C T 9: 18,484,929 P117S possibly damaging Het
Med18 A T 4: 132,460,109 S71R probably damaging Het
Mov10l1 T A 15: 89,011,404 I643N possibly damaging Het
Nfib T C 4: 82,498,589 K70E probably damaging Het
Nr6a1 A T 2: 38,738,943 F356L probably benign Het
Oca2 G A 7: 56,328,785 R567H probably damaging Het
Olfr370 A G 8: 83,541,416 S91G probably benign Het
Olfr395 T A 11: 73,907,085 M136L possibly damaging Het
Olfr59 T C 11: 74,288,811 L55P probably damaging Het
Olfr794 T A 10: 129,570,828 Y58N probably damaging Het
Olfr952 T C 9: 39,426,958 T38A probably damaging Het
Pcdhb10 A G 18: 37,412,956 T362A probably benign Het
Pip5k1b A T 19: 24,397,040 V59E probably damaging Het
Pkhd1l1 G A 15: 44,547,509 probably null Het
Prr36 T C 8: 4,214,370 probably benign Het
Ptger2 A G 14: 45,001,771 T289A probably benign Het
Rad18 A G 6: 112,681,537 F136L probably damaging Het
Rhbg T A 3: 88,245,874 S258C probably damaging Het
Scgb2b27 T C 7: 34,013,314 I34M possibly damaging Het
Senp7 C A 16: 56,123,799 T135K probably damaging Het
Slc20a2 A G 8: 22,545,566 I193M probably damaging Het
Slc27a1 G A 8: 71,570,860 V47I probably benign Het
Slc9a5 G A 8: 105,368,134 V786M probably damaging Het
Smyd1 A G 6: 71,216,891 L350P probably damaging Het
Ston2 A T 12: 91,647,907 F576I probably damaging Het
Sulf2 A T 2: 166,082,678 V496E probably benign Het
Tcl1b3 C A 12: 105,191,222 S41Y probably damaging Het
Tulp2 A T 7: 45,519,777 N256I probably damaging Het
Uspl1 T A 5: 149,201,858 C349S probably damaging Het
Vcl T C 14: 21,020,536 I730T probably damaging Het
Vmn1r61 A T 7: 5,611,061 F85I probably benign Het
Zfp318 A G 17: 46,399,477 T709A probably benign Het
Zfr2 T C 10: 81,242,085 S249P probably damaging Het
Other mutations in Nr3c2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00691:Nr3c2 APN 8 76909590 missense possibly damaging 0.82
IGL01019:Nr3c2 APN 8 76909214 missense probably damaging 0.99
IGL01085:Nr3c2 APN 8 76908354 missense probably benign 0.02
IGL01395:Nr3c2 APN 8 76908848 missense possibly damaging 0.73
IGL01505:Nr3c2 APN 8 76909187 missense probably damaging 1.00
IGL01656:Nr3c2 APN 8 77187537 missense probably damaging 1.00
IGL01802:Nr3c2 APN 8 76908595 nonsense probably null
IGL02147:Nr3c2 APN 8 76909067 missense probably damaging 0.98
IGL02502:Nr3c2 APN 8 77242514 missense probably damaging 1.00
IGL02706:Nr3c2 APN 8 76908416 unclassified probably null
IGL02945:Nr3c2 APN 8 76909659 missense probably damaging 1.00
IGL03034:Nr3c2 APN 8 77187638 nonsense probably null
IGL03162:Nr3c2 APN 8 77217584 missense probably damaging 0.99
naughty UTSW 8 76908668 unclassified probably null
R0141:Nr3c2 UTSW 8 76908408 missense probably damaging 0.99
R0422:Nr3c2 UTSW 8 77185967 missense probably benign
R0458:Nr3c2 UTSW 8 76909538 missense probably damaging 1.00
R0595:Nr3c2 UTSW 8 76909604 missense possibly damaging 0.93
R0615:Nr3c2 UTSW 8 77185889 missense probably benign 0.05
R0964:Nr3c2 UTSW 8 76908668 unclassified probably null
R0989:Nr3c2 UTSW 8 77187564 missense probably damaging 0.97
R1532:Nr3c2 UTSW 8 76909104 missense probably damaging 0.99
R1624:Nr3c2 UTSW 8 76909944 missense probably damaging 1.00
R1965:Nr3c2 UTSW 8 76909463 missense probably damaging 0.99
R2011:Nr3c2 UTSW 8 76909793 missense possibly damaging 0.53
R2110:Nr3c2 UTSW 8 76908527 missense possibly damaging 0.75
R2281:Nr3c2 UTSW 8 76909907 missense probably damaging 0.99
R3782:Nr3c2 UTSW 8 77085684 splice site probably null
R3808:Nr3c2 UTSW 8 76908714 missense probably damaging 1.00
R4133:Nr3c2 UTSW 8 76909749 missense probably damaging 1.00
R4433:Nr3c2 UTSW 8 77217467 missense probably damaging 1.00
R4738:Nr3c2 UTSW 8 76909307 missense possibly damaging 0.94
R4770:Nr3c2 UTSW 8 76908243 intron probably null
R4884:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R5169:Nr3c2 UTSW 8 76909037 missense probably damaging 1.00
R5347:Nr3c2 UTSW 8 77210748 missense possibly damaging 0.92
R5857:Nr3c2 UTSW 8 76908867 missense possibly damaging 0.53
R5878:Nr3c2 UTSW 8 76908268 critical splice acceptor site probably null
R6262:Nr3c2 UTSW 8 76908633 missense possibly damaging 0.65
R6547:Nr3c2 UTSW 8 76908809 missense possibly damaging 0.53
R6820:Nr3c2 UTSW 8 77242457 missense probably damaging 0.98
R7180:Nr3c2 UTSW 8 76908963 missense probably damaging 0.99
R7672:Nr3c2 UTSW 8 76909209 missense probably damaging 1.00
R7741:Nr3c2 UTSW 8 77210646 missense probably damaging 0.97
R7776:Nr3c2 UTSW 8 76909545 missense possibly damaging 0.77
R7800:Nr3c2 UTSW 8 76909992 missense probably damaging 1.00
Z1088:Nr3c2 UTSW 8 76908632 missense possibly damaging 0.48
Z1176:Nr3c2 UTSW 8 76909700
Predicted Primers PCR Primer
(F):5'- TGTTCTTTACAAACTGCCAAGGCCC -3'
(R):5'- TCTGATGGCAAAATCCCAGACCG -3'

Sequencing Primer
(F):5'- GCAATTGGTTCTTCTGGATTCTAAAG -3'
(R):5'- AGACCGACTATTGTCTTGCTGAAG -3'
Posted On2014-05-23