Incidental Mutation 'R1737:Aldh1a2'
ID199794
Institutional Source Beutler Lab
Gene Symbol Aldh1a2
Ensembl Gene ENSMUSG00000013584
Gene Namealdehyde dehydrogenase family 1, subfamily A2
Synonymsretinaldehyde dehydrogenase, Aldh1a7, Raldh2
MMRRC Submission 039769-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1737 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location71215789-71296243 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71285171 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 436 (E436V)
Ref Sequence ENSEMBL: ENSMUSP00000034723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034723]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034723
AA Change: E436V

PolyPhen 2 Score 0.559 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000034723
Gene: ENSMUSG00000013584
AA Change: E436V

DomainStartEndE-ValueType
Pfam:Aldedh 46 509 2.5e-187 PFAM
Meta Mutation Damage Score 0.2069 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.4%
Validation Efficiency 100% (75/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. The product of this gene is an enzyme that catalyzes the synthesis of retinoic acid (RA) from retinaldehyde. Retinoic acid, the active derivative of vitamin A (retinol), is a hormonal signaling molecule that functions in developing and adult tissues. The studies of a similar mouse gene suggest that this enzyme and the cytochrome CYP26A1, concurrently establish local embryonic retinoic acid levels which facilitate posterior organ development and prevent spina bifida. Four transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2011]
PHENOTYPE: Homozygotes for null mutations are largely devoid of retinoic acid and die by embryonic day 10.5 with impaired hindbrain development, failure to turn, lack of limb buds, heart abnormalities, reduced otocysts and a truncated frontonasal region. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Ak7 G A 12: 105,742,332 V349M probably damaging Het
Apc C A 18: 34,317,022 P2290T probably damaging Het
Atp10a T C 7: 58,827,238 probably benign Het
Bahd1 T C 2: 118,915,923 S8P probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Capn10 T C 1: 92,934,955 Y28H probably benign Het
Ccdc129 A T 6: 55,968,304 D670V probably damaging Het
Cdh10 A T 15: 18,964,063 I104F probably damaging Het
Cep170b A G 12: 112,736,627 D508G possibly damaging Het
Ces2a G T 8: 104,740,824 A494S probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cltc G A 11: 86,733,727 T123M probably damaging Het
Cnot1 A G 8: 95,748,276 S1102P probably damaging Het
Col12a1 C A 9: 79,703,451 D224Y probably damaging Het
Col14a1 T A 15: 55,344,961 probably benign Het
Cyp7a1 T A 4: 6,272,848 T122S probably benign Het
Dock4 A G 12: 40,807,001 probably null Het
Eid2 T C 7: 28,268,499 V182A possibly damaging Het
Eloa A T 4: 136,010,770 V293D probably benign Het
Enkur G A 2: 21,194,295 P143S probably damaging Het
Ep300 T C 15: 81,626,347 Y99H probably damaging Het
Fbxw5 C A 2: 25,503,584 L66I probably benign Het
Flg2 A T 3: 93,203,621 R985S unknown Het
Fscb A T 12: 64,474,581 I37K possibly damaging Het
H2-M10.3 T C 17: 36,368,404 N3S probably benign Het
H2-Q7 A C 17: 35,439,626 Y80S probably damaging Het
H60c A T 10: 3,259,914 D124E possibly damaging Het
Hsd3b2 A T 3: 98,711,546 V361E probably damaging Het
Ice1 A C 13: 70,606,325 C547W probably damaging Het
Jmy A G 13: 93,498,795 V171A probably damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Klk1b1 A T 7: 43,970,359 Q114L probably benign Het
Krt10 A G 11: 99,387,387 M280T possibly damaging Het
Lama1 G A 17: 67,802,921 R2179Q probably benign Het
Mbd3l1 C T 9: 18,484,929 P117S possibly damaging Het
Med18 A T 4: 132,460,109 S71R probably damaging Het
Mov10l1 T A 15: 89,011,404 I643N possibly damaging Het
Nfib T C 4: 82,498,589 K70E probably damaging Het
Nr3c2 A C 8: 76,908,329 S20R probably benign Het
Nr6a1 A T 2: 38,738,943 F356L probably benign Het
Oca2 G A 7: 56,328,785 R567H probably damaging Het
Olfr370 A G 8: 83,541,416 S91G probably benign Het
Olfr395 T A 11: 73,907,085 M136L possibly damaging Het
Olfr59 T C 11: 74,288,811 L55P probably damaging Het
Olfr794 T A 10: 129,570,828 Y58N probably damaging Het
Olfr952 T C 9: 39,426,958 T38A probably damaging Het
Pcdhb10 A G 18: 37,412,956 T362A probably benign Het
Pip5k1b A T 19: 24,397,040 V59E probably damaging Het
Pkhd1l1 G A 15: 44,547,509 probably null Het
Prr36 T C 8: 4,214,370 probably benign Het
Ptger2 A G 14: 45,001,771 T289A probably benign Het
Rad18 A G 6: 112,681,537 F136L probably damaging Het
Rhbg T A 3: 88,245,874 S258C probably damaging Het
Scgb2b27 T C 7: 34,013,314 I34M possibly damaging Het
Senp7 C A 16: 56,123,799 T135K probably damaging Het
Slc20a2 A G 8: 22,545,566 I193M probably damaging Het
Slc27a1 G A 8: 71,570,860 V47I probably benign Het
Slc9a5 G A 8: 105,368,134 V786M probably damaging Het
Smyd1 A G 6: 71,216,891 L350P probably damaging Het
Ston2 A T 12: 91,647,907 F576I probably damaging Het
Sulf2 A T 2: 166,082,678 V496E probably benign Het
Tcl1b3 C A 12: 105,191,222 S41Y probably damaging Het
Tulp2 A T 7: 45,519,777 N256I probably damaging Het
Uspl1 T A 5: 149,201,858 C349S probably damaging Het
Vcl T C 14: 21,020,536 I730T probably damaging Het
Vmn1r61 A T 7: 5,611,061 F85I probably benign Het
Zfp318 A G 17: 46,399,477 T709A probably benign Het
Zfr2 T C 10: 81,242,085 S249P probably damaging Het
Other mutations in Aldh1a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00931:Aldh1a2 APN 9 71215969 splice site probably benign
IGL01327:Aldh1a2 APN 9 71285966 missense possibly damaging 0.95
IGL02293:Aldh1a2 APN 9 71285277 splice site probably null
IGL03380:Aldh1a2 APN 9 71255117 nonsense probably null
R0574:Aldh1a2 UTSW 9 71281708 critical splice donor site probably null
R1189:Aldh1a2 UTSW 9 71263823 missense possibly damaging 0.69
R1217:Aldh1a2 UTSW 9 71281682 missense possibly damaging 0.94
R1270:Aldh1a2 UTSW 9 71281706 missense probably benign 0.03
R1445:Aldh1a2 UTSW 9 71285210 missense possibly damaging 0.82
R1717:Aldh1a2 UTSW 9 71293671 missense probably damaging 0.99
R1755:Aldh1a2 UTSW 9 71261741 nonsense probably null
R1984:Aldh1a2 UTSW 9 71253052 missense probably damaging 1.00
R2248:Aldh1a2 UTSW 9 71215862 missense possibly damaging 0.90
R2407:Aldh1a2 UTSW 9 71252598 missense probably damaging 0.99
R3772:Aldh1a2 UTSW 9 71252920 missense probably damaging 1.00
R4945:Aldh1a2 UTSW 9 71215916 missense probably benign 0.00
R5042:Aldh1a2 UTSW 9 71285004 missense possibly damaging 0.69
R5066:Aldh1a2 UTSW 9 71281700 missense possibly damaging 0.82
R5406:Aldh1a2 UTSW 9 71255121 missense possibly damaging 0.93
R5425:Aldh1a2 UTSW 9 71253004 missense probably benign 0.00
R5588:Aldh1a2 UTSW 9 71283450 missense probably damaging 1.00
R6048:Aldh1a2 UTSW 9 71261767 missense probably damaging 0.98
R6455:Aldh1a2 UTSW 9 71252914 critical splice acceptor site probably null
R6642:Aldh1a2 UTSW 9 71252986 missense probably damaging 1.00
R7253:Aldh1a2 UTSW 9 71215934 missense probably benign
R7514:Aldh1a2 UTSW 9 71284963 missense probably damaging 1.00
R7981:Aldh1a2 UTSW 9 71263820 missense probably damaging 1.00
RF018:Aldh1a2 UTSW 9 71285270 missense probably damaging 1.00
Z1177:Aldh1a2 UTSW 9 71283522 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TGACATGCGGATTGCCAAGGAG -3'
(R):5'- TCTGACCATGCTCACTGGACTCAC -3'

Sequencing Primer
(F):5'- GGAGGTGAGGGATCACGC -3'
(R):5'- CTCCTCTCTTTGAAATACGGTTAG -3'
Posted On2014-05-23