Incidental Mutation 'R1737:Apc'
ID199824
Institutional Source Beutler Lab
Gene Symbol Apc
Ensembl Gene ENSMUSG00000005871
Gene Nameadenomatosis polyposis coli
SynonymsCC1, Min
MMRRC Submission 039769-MU
Accession Numbers

Ncbi RefSeq: NM_007462.3; MGI:88039

Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R1737 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location34220924-34322189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34317022 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 2290 (P2290T)
Ref Sequence ENSEMBL: ENSMUSP00000111447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079362] [ENSMUST00000115781] [ENSMUST00000171187]
Predicted Effect probably damaging
Transcript: ENSMUST00000079362
AA Change: P2324T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078337
Gene: ENSMUSG00000005871
AA Change: P2324T

DomainStartEndE-ValueType
Pfam:APC_N_CC 4 55 6e-32 PFAM
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 125 205 2e-24 PFAM
low complexity region 211 222 N/A INTRINSIC
low complexity region 234 247 N/A INTRINSIC
ARM 338 390 6.14e-5 SMART
ARM 457 508 1.62e-4 SMART
ARM 510 551 8.56e-4 SMART
ARM 554 595 4.45e-2 SMART
ARM 597 642 5.76e1 SMART
ARM 647 687 1.29e-7 SMART
Pfam:Arm_APC_u3 730 1017 5e-170 PFAM
Pfam:APC_15aa 1018 1032 1.1e-8 PFAM
Pfam:APC_u5 1034 1133 7.6e-55 PFAM
Pfam:APC_15aa 1154 1168 1.6e-8 PFAM
Pfam:APC_15aa 1171 1185 1.9e-9 PFAM
low complexity region 1187 1204 N/A INTRINSIC
Pfam:APC_crr 1255 1279 1.5e-15 PFAM
Pfam:APC_u9 1280 1367 1.9e-34 PFAM
Pfam:APC_crr 1370 1393 2.2e-10 PFAM
low complexity region 1431 1449 N/A INTRINSIC
Pfam:APC_crr 1485 1509 2.1e-9 PFAM
low complexity region 1532 1548 N/A INTRINSIC
Pfam:SAMP 1568 1587 2.7e-11 PFAM
Pfam:APC_crr 1635 1659 1.9e-15 PFAM
Pfam:APC_u13 1660 1716 1.3e-31 PFAM
Pfam:SAMP 1717 1736 3.2e-12 PFAM
Pfam:APC_u14 1737 1837 1e-46 PFAM
Pfam:APC_crr 1839 1864 6.8e-15 PFAM
Pfam:APC_u15 1865 1945 1.8e-40 PFAM
Pfam:APC_crr 1947 1971 1.6e-14 PFAM
Pfam:APC_crr 2007 2030 1.8e-14 PFAM
Pfam:SAMP 2033 2052 1.6e-13 PFAM
low complexity region 2112 2146 N/A INTRINSIC
Pfam:APC_basic 2223 2579 1.5e-110 PFAM
low complexity region 2626 2638 N/A INTRINSIC
Pfam:EB1_binding 2670 2842 9.3e-89 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115781
AA Change: P2290T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111447
Gene: ENSMUSG00000005871
AA Change: P2290T

DomainStartEndE-ValueType
PDB:1DEB|B 2 55 1e-27 PDB
low complexity region 92 109 N/A INTRINSIC
Pfam:Suppressor_APC 124 206 1.5e-31 PFAM
low complexity region 211 222 N/A INTRINSIC
ARM 304 356 6.14e-5 SMART
ARM 423 474 1.62e-4 SMART
ARM 476 517 8.56e-4 SMART
ARM 520 561 4.45e-2 SMART
ARM 563 608 5.76e1 SMART
ARM 613 653 1.29e-7 SMART
Pfam:Arm 655 695 1.7e-6 PFAM
low complexity region 797 810 N/A INTRINSIC
low complexity region 880 892 N/A INTRINSIC
low complexity region 923 935 N/A INTRINSIC
Pfam:APC_15aa 984 999 3.7e-9 PFAM
Pfam:APC_15aa 1100 1115 8.4e-8 PFAM
Pfam:APC_15aa 1120 1135 9.9e-9 PFAM
Pfam:APC_15aa 1137 1152 1.2e-9 PFAM
low complexity region 1153 1170 N/A INTRINSIC
Pfam:APC_crr 1220 1245 7.5e-15 PFAM
low complexity region 1320 1331 N/A INTRINSIC
Pfam:APC_crr 1334 1359 2.8e-11 PFAM
low complexity region 1397 1415 N/A INTRINSIC
Pfam:APC_crr 1450 1475 2.2e-8 PFAM
low complexity region 1498 1514 N/A INTRINSIC
Pfam:SAMP 1533 1553 8.4e-12 PFAM
Pfam:APC_crr 1600 1625 3.5e-13 PFAM
Pfam:SAMP 1682 1702 5e-12 PFAM
low complexity region 1732 1744 N/A INTRINSIC
Pfam:APC_crr 1805 1830 3.1e-12 PFAM
low complexity region 1866 1877 N/A INTRINSIC
Pfam:APC_crr 1912 1937 3.5e-13 PFAM
Pfam:APC_crr 1971 1996 7.1e-14 PFAM
Pfam:SAMP 1999 2018 4.6e-13 PFAM
low complexity region 2078 2112 N/A INTRINSIC
Pfam:APC_basic 2189 2545 1.1e-131 PFAM
low complexity region 2592 2604 N/A INTRINSIC
Pfam:EB1_binding 2636 2808 2.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165590
SMART Domains Protein: ENSMUSP00000128327
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
PDB:3AU3|A 2 33 2e-17 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000171187
SMART Domains Protein: ENSMUSP00000127131
Gene: ENSMUSG00000005871

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
low complexity region 23 52 N/A INTRINSIC
low complexity region 102 119 N/A INTRINSIC
Pfam:Suppressor_APC 134 216 5.2e-32 PFAM
ARM 320 372 6.14e-5 SMART
ARM 439 490 1.62e-4 SMART
ARM 492 533 8.56e-4 SMART
ARM 536 577 4.45e-2 SMART
ARM 579 624 5.76e1 SMART
ARM 629 669 1.29e-7 SMART
Pfam:Arm 671 711 6.3e-7 PFAM
low complexity region 813 826 N/A INTRINSIC
low complexity region 896 908 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
Pfam:APC_15aa 1000 1015 1.4e-9 PFAM
Pfam:APC_15aa 1116 1131 3.1e-8 PFAM
Meta Mutation Damage Score 0.2386 question?
Coding Region Coverage
  • 1x: 97.6%
  • 3x: 96.9%
  • 10x: 95.1%
  • 20x: 91.4%
Validation Efficiency 100% (75/75)
MGI Phenotype Strain: 1856318; 2387050; 1857951; 1857957
Lethality: E8-E12
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tumor suppressor protein that acts as an antagonist of the Wnt signaling pathway. It is also involved in other processes including cell migration and adhesion, transcriptional activation, and apoptosis. Defects in this gene cause familial adenomatous polyposis (FAP), an autosomal dominant pre-malignant disease that usually progresses to malignancy. Disease-associated mutations tend to be clustered in a small region designated the mutation cluster region (MCR) and result in a truncated protein product. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most targeted and hypomorphic heterozygous mutants develop intestinal polyps and colorectal cancer, associated with anemia from intestinal bleeding. Homozygotes are embryonic lethal. Homozygotes for a mild alleles survive and have less extreme tumor incidence. [provided by MGI curators]
Allele List at MGI

All alleles(88) : Targeted(25) Gene trapped(62) Chemically induced(1)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts16 G A 13: 70,779,518 probably benign Het
Ak7 G A 12: 105,742,332 V349M probably damaging Het
Aldh1a2 A T 9: 71,285,171 E436V possibly damaging Het
Atp10a T C 7: 58,827,238 probably benign Het
Bahd1 T C 2: 118,915,923 S8P probably damaging Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
Capn10 T C 1: 92,934,955 Y28H probably benign Het
Ccdc129 A T 6: 55,968,304 D670V probably damaging Het
Cdh10 A T 15: 18,964,063 I104F probably damaging Het
Cep170b A G 12: 112,736,627 D508G possibly damaging Het
Ces2a G T 8: 104,740,824 A494S probably damaging Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Cltc G A 11: 86,733,727 T123M probably damaging Het
Cnot1 A G 8: 95,748,276 S1102P probably damaging Het
Col12a1 C A 9: 79,703,451 D224Y probably damaging Het
Col14a1 T A 15: 55,344,961 probably benign Het
Cyp7a1 T A 4: 6,272,848 T122S probably benign Het
Dock4 A G 12: 40,807,001 probably null Het
Eid2 T C 7: 28,268,499 V182A possibly damaging Het
Eloa A T 4: 136,010,770 V293D probably benign Het
Enkur G A 2: 21,194,295 P143S probably damaging Het
Ep300 T C 15: 81,626,347 Y99H probably damaging Het
Fbxw5 C A 2: 25,503,584 L66I probably benign Het
Flg2 A T 3: 93,203,621 R985S unknown Het
Fscb A T 12: 64,474,581 I37K possibly damaging Het
H2-M10.3 T C 17: 36,368,404 N3S probably benign Het
H2-Q7 A C 17: 35,439,626 Y80S probably damaging Het
H60c A T 10: 3,259,914 D124E possibly damaging Het
Hsd3b2 A T 3: 98,711,546 V361E probably damaging Het
Ice1 A C 13: 70,606,325 C547W probably damaging Het
Jmy A G 13: 93,498,795 V171A probably damaging Het
Klf7 C A 1: 64,079,213 R75L possibly damaging Het
Klk1b1 A T 7: 43,970,359 Q114L probably benign Het
Krt10 A G 11: 99,387,387 M280T possibly damaging Het
Lama1 G A 17: 67,802,921 R2179Q probably benign Het
Mbd3l1 C T 9: 18,484,929 P117S possibly damaging Het
Med18 A T 4: 132,460,109 S71R probably damaging Het
Mov10l1 T A 15: 89,011,404 I643N possibly damaging Het
Nfib T C 4: 82,498,589 K70E probably damaging Het
Nr3c2 A C 8: 76,908,329 S20R probably benign Het
Nr6a1 A T 2: 38,738,943 F356L probably benign Het
Oca2 G A 7: 56,328,785 R567H probably damaging Het
Olfr370 A G 8: 83,541,416 S91G probably benign Het
Olfr395 T A 11: 73,907,085 M136L possibly damaging Het
Olfr59 T C 11: 74,288,811 L55P probably damaging Het
Olfr794 T A 10: 129,570,828 Y58N probably damaging Het
Olfr952 T C 9: 39,426,958 T38A probably damaging Het
Pcdhb10 A G 18: 37,412,956 T362A probably benign Het
Pip5k1b A T 19: 24,397,040 V59E probably damaging Het
Pkhd1l1 G A 15: 44,547,509 probably null Het
Prr36 T C 8: 4,214,370 probably benign Het
Ptger2 A G 14: 45,001,771 T289A probably benign Het
Rad18 A G 6: 112,681,537 F136L probably damaging Het
Rhbg T A 3: 88,245,874 S258C probably damaging Het
Scgb2b27 T C 7: 34,013,314 I34M possibly damaging Het
Senp7 C A 16: 56,123,799 T135K probably damaging Het
Slc20a2 A G 8: 22,545,566 I193M probably damaging Het
Slc27a1 G A 8: 71,570,860 V47I probably benign Het
Slc9a5 G A 8: 105,368,134 V786M probably damaging Het
Smyd1 A G 6: 71,216,891 L350P probably damaging Het
Ston2 A T 12: 91,647,907 F576I probably damaging Het
Sulf2 A T 2: 166,082,678 V496E probably benign Het
Tcl1b3 C A 12: 105,191,222 S41Y probably damaging Het
Tulp2 A T 7: 45,519,777 N256I probably damaging Het
Uspl1 T A 5: 149,201,858 C349S probably damaging Het
Vcl T C 14: 21,020,536 I730T probably damaging Het
Vmn1r61 A T 7: 5,611,061 F85I probably benign Het
Zfp318 A G 17: 46,399,477 T709A probably benign Het
Zfr2 T C 10: 81,242,085 S249P probably damaging Het
Other mutations in Apc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00507:Apc APN 18 34316926 missense probably benign 0.01
IGL00898:Apc APN 18 34317094 missense probably damaging 1.00
IGL01111:Apc APN 18 34315136 missense possibly damaging 0.95
IGL01347:Apc APN 18 34317670 missense probably damaging 1.00
IGL01375:Apc APN 18 34313654 missense probably damaging 1.00
IGL01805:Apc APN 18 34318218 missense probably benign 0.02
IGL01997:Apc APN 18 34315423 missense probably benign 0.00
IGL02033:Apc APN 18 34310719 missense probably damaging 1.00
IGL02323:Apc APN 18 34315810 nonsense probably null
IGL02373:Apc APN 18 34316159 missense probably damaging 1.00
IGL02379:Apc APN 18 34298745 missense probably benign 0.45
IGL02456:Apc APN 18 34313882 nonsense probably null
IGL02552:Apc APN 18 34312982 missense possibly damaging 0.90
IGL02676:Apc APN 18 34315634 missense probably damaging 1.00
IGL02756:Apc APN 18 34314535 missense probably damaging 1.00
IGL02938:Apc APN 18 34315228 missense probably damaging 0.98
IGL02974:Apc APN 18 34268383 splice site probably benign
IGL03124:Apc APN 18 34299985 missense probably damaging 0.98
IGL03201:Apc APN 18 34312376 missense probably damaging 1.00
IGL03339:Apc APN 18 34298474 missense probably damaging 1.00
FR4304:Apc UTSW 18 34281997 intron probably benign
FR4342:Apc UTSW 18 34281999 intron probably benign
FR4449:Apc UTSW 18 34282000 intron probably benign
FR4449:Apc UTSW 18 34282005 intron probably benign
FR4548:Apc UTSW 18 34281998 intron probably benign
FR4737:Apc UTSW 18 34281999 intron probably benign
FR4976:Apc UTSW 18 34281998 intron probably benign
FR4976:Apc UTSW 18 34282000 intron probably benign
FR4976:Apc UTSW 18 34282004 nonsense probably null
R0385:Apc UTSW 18 34315944 missense probably damaging 1.00
R0535:Apc UTSW 18 34261072 missense probably damaging 1.00
R0561:Apc UTSW 18 34313303 missense possibly damaging 0.94
R0590:Apc UTSW 18 34316230 nonsense probably null
R0626:Apc UTSW 18 34318454 missense probably damaging 1.00
R0991:Apc UTSW 18 34316107 missense probably damaging 1.00
R1564:Apc UTSW 18 34315149 missense probably benign 0.00
R1663:Apc UTSW 18 34268325 missense probably damaging 0.98
R1739:Apc UTSW 18 34312318 missense probably damaging 1.00
R1835:Apc UTSW 18 34317077 missense probably damaging 1.00
R1887:Apc UTSW 18 34272468 missense probably damaging 1.00
R1957:Apc UTSW 18 34317335 missense probably damaging 1.00
R1974:Apc UTSW 18 34300004 missense possibly damaging 0.62
R2005:Apc UTSW 18 34310909 critical splice donor site probably null
R2013:Apc UTSW 18 34315591 missense probably damaging 0.98
R2014:Apc UTSW 18 34315591 missense probably damaging 0.98
R2015:Apc UTSW 18 34315591 missense probably damaging 0.98
R2017:Apc UTSW 18 34313602 missense probably benign 0.00
R2056:Apc UTSW 18 34316428 missense probably damaging 1.00
R2108:Apc UTSW 18 34269229 missense probably damaging 1.00
R2120:Apc UTSW 18 34276601 missense probably damaging 1.00
R2131:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2133:Apc UTSW 18 34312045 missense possibly damaging 0.51
R2291:Apc UTSW 18 34312491 missense probably benign 0.45
R2332:Apc UTSW 18 34317059 missense possibly damaging 0.50
R2360:Apc UTSW 18 34261126 missense probably damaging 1.00
R2407:Apc UTSW 18 34314262 missense possibly damaging 0.77
R2507:Apc UTSW 18 34316537 missense possibly damaging 0.77
R2940:Apc UTSW 18 34276670 missense probably damaging 1.00
R3404:Apc UTSW 18 34313602 missense probably benign 0.00
R3411:Apc UTSW 18 34269259 splice site probably benign
R3778:Apc UTSW 18 34313081 missense probably damaging 1.00
R3826:Apc UTSW 18 34279335 missense possibly damaging 0.93
R4599:Apc UTSW 18 34317987 nonsense probably null
R4611:Apc UTSW 18 34318565 missense probably damaging 1.00
R4664:Apc UTSW 18 34298594 missense probably damaging 0.98
R4969:Apc UTSW 18 34312918 nonsense probably null
R5007:Apc UTSW 18 34312963 missense probably damaging 1.00
R5066:Apc UTSW 18 34316105 missense probably damaging 1.00
R5112:Apc UTSW 18 34316109 nonsense probably null
R5259:Apc UTSW 18 34314290 missense probably benign 0.29
R5440:Apc UTSW 18 34221160 unclassified probably benign
R5508:Apc UTSW 18 34298580 missense probably damaging 0.97
R5512:Apc UTSW 18 34310909 critical splice donor site probably benign
R5850:Apc UTSW 18 34318063 missense possibly damaging 0.94
R5951:Apc UTSW 18 34317146 missense possibly damaging 0.89
R5966:Apc UTSW 18 34221087 utr 5 prime probably benign
R6081:Apc UTSW 18 34290111 missense possibly damaging 0.93
R6116:Apc UTSW 18 34316455 missense probably damaging 1.00
R6351:Apc UTSW 18 34312212 missense probably damaging 1.00
R6354:Apc UTSW 18 34312528 missense probably benign 0.02
R6467:Apc UTSW 18 34269199 missense probably benign 0.22
R6974:Apc UTSW 18 34298427 missense possibly damaging 0.65
R7027:Apc UTSW 18 34312076 missense probably damaging 1.00
R7096:Apc UTSW 18 34315957 missense probably damaging 1.00
R7289:Apc UTSW 18 34315271 missense probably damaging 1.00
R7439:Apc UTSW 18 34312073 missense probably damaging 1.00
R7441:Apc UTSW 18 34312073 missense probably damaging 1.00
R7534:Apc UTSW 18 34316962 missense probably damaging 1.00
R7685:Apc UTSW 18 34314208 missense probably damaging 1.00
R7814:Apc UTSW 18 34272539 missense probably damaging 0.98
RF046:Apc UTSW 18 34282009 critical splice donor site probably benign
RF063:Apc UTSW 18 34282009 critical splice donor site probably benign
X0021:Apc UTSW 18 34312108 missense probably damaging 1.00
X0025:Apc UTSW 18 34312376 missense probably damaging 1.00
Z1088:Apc UTSW 18 34313167 nonsense probably null
Z1177:Apc UTSW 18 34314463 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CTCAAGAGGCAGGACGATGATTCAC -3'
(R):5'- ATGCCGACTCACTTCTGGGGATAC -3'

Sequencing Primer
(F):5'- CTTCGGAATAGCTCCTCTAGTACAAG -3'
(R):5'- CTGGCATTCTTGGATAAACTTGC -3'
Posted On2014-05-23