Incidental Mutation 'R1738:Pde6b'
ID199856
Institutional Source Beutler Lab
Gene Symbol Pde6b
Ensembl Gene ENSMUSG00000029491
Gene Namephosphodiesterase 6B, cGMP, rod receptor, beta polypeptide
Synonymsrd10, Pdeb, rd, rd1, r
MMRRC Submission 039770-MU
Accession Numbers

Genbank: NM_008806; MGI: 97525

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1738 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location108388391-108432397 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 108430559 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 788 (R788*)
Ref Sequence ENSEMBL: ENSMUSP00000031456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031456] [ENSMUST00000049628] [ENSMUST00000118632]
Predicted Effect probably null
Transcript: ENSMUST00000031456
AA Change: R788*
SMART Domains Protein: ENSMUSP00000031456
Gene: ENSMUSG00000029491
AA Change: R788*

DomainStartEndE-ValueType
GAF 71 230 1.29e-27 SMART
GAF 252 439 5.76e-25 SMART
Blast:HDc 484 538 1e-24 BLAST
HDc 554 732 1.25e-9 SMART
Blast:HDc 757 792 8e-13 BLAST
low complexity region 813 837 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000049628
SMART Domains Protein: ENSMUSP00000051222
Gene: ENSMUSG00000050856

DomainStartEndE-ValueType
Pfam:ATP-synt_E 2 69 6.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118632
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123184
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134865
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.7%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Photon absorption triggers a signaling cascade in rod photoreceptors that activates cGMP phosphodiesterase (PDE), resulting in the rapid hydrolysis of cGMP, closure of cGMP-gated cation channels, and hyperpolarization of the cell. PDE is a peripheral membrane heterotrimeric enzyme made up of alpha, beta, and gamma subunits. This gene encodes the beta subunit. Mutations in this gene result in retinitis pigmentosa and autosomal dominant congenital stationary night blindness. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for the rd1 mutation have severe retinal degeneration and vision loss. Rod cells are lost by 35 days of age; cone cells degenerate slower and some light sensitivity persists. Other allelic mutations produce similar or milder phenotypes. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted, knock-out(1) Targeted, other(1) Spontaneous(2) Chemically induced(9)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,611 Y202C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl3 T G 5: 81,387,979 M155R probably damaging Het
Ak9 A T 10: 41,335,921 Q218L possibly damaging Het
Akap13 G A 7: 75,677,194 G647D probably damaging Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Arhgap19 A G 19: 41,784,381 I291T probably benign Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
BC067074 T G 13: 113,367,500 L179R possibly damaging Het
Bsn T C 9: 108,106,934 D3307G unknown Het
Ces2h T A 8: 105,019,065 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a3 T C 1: 90,816,361 E88G probably damaging Het
Coro6 A G 11: 77,469,425 D407G probably benign Het
Cpe A T 8: 64,611,441 F241L probably damaging Het
Csde1 A G 3: 103,029,177 probably benign Het
Dgki A G 6: 37,057,432 I361T possibly damaging Het
Dnah3 A G 7: 120,035,359 V1298A probably damaging Het
Duox2 T A 2: 122,293,414 I430F probably damaging Het
Gak T C 5: 108,616,976 Y153C probably damaging Het
Gal3st2 T A 1: 93,874,596 probably null Het
Gbp11 T C 5: 105,326,644 N389D probably benign Het
Grm1 A G 10: 10,936,419 V287A probably damaging Het
Hsp90ab1 T C 17: 45,571,806 K36E probably damaging Het
Il24 T A 1: 130,887,362 probably null Het
Ino80d T C 1: 63,093,465 D13G probably damaging Het
Ipp G A 4: 116,530,421 V399I probably benign Het
Kank3 A T 17: 33,817,194 D12V probably damaging Het
Lcn12 A T 2: 25,493,251 S74R probably damaging Het
Mast3 T C 8: 70,784,556 T637A probably benign Het
Nes C A 3: 87,976,421 Y662* probably null Het
Nudt13 A T 14: 20,309,694 H163L probably damaging Het
Olfr1046 A T 2: 86,217,716 probably null Het
Olfr1178 G A 2: 88,391,327 V27I probably benign Het
Olfr1239 T C 2: 89,418,018 T132A probably benign Het
Olfr346 T C 2: 36,688,785 V261A probably benign Het
Pex13 A G 11: 23,649,458 L351P probably benign Het
Phc1 A G 6: 122,318,566 M942T probably damaging Het
Plch1 A T 3: 63,719,238 D571E probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhh2 A G 17: 84,566,697 N470S possibly damaging Het
Primpol A G 8: 46,607,838 S82P probably damaging Het
Prkg1 T C 19: 30,786,922 D256G possibly damaging Het
Prune2 A G 19: 17,125,010 E2511G probably benign Het
Rassf8 T C 6: 145,815,308 I120T probably benign Het
Rfx4 G A 10: 84,880,975 probably null Het
Rtp2 A T 16: 23,927,673 N69K probably benign Het
Sh3d19 A T 3: 86,120,606 I597F probably damaging Het
Sorl1 T A 9: 42,089,965 E246D probably benign Het
Spert C T 14: 75,593,057 M1I probably null Het
Tet2 T A 3: 133,481,387 I1094L probably benign Het
Tlr4 A T 4: 66,841,076 H702L probably benign Het
Tnfrsf14 T C 4: 154,925,331 D47G probably damaging Het
Ttn T C 2: 76,946,813 Y1415C probably damaging Het
Vmn2r17 T A 5: 109,428,511 F416Y probably benign Het
Vmn2r54 A G 7: 12,635,888 S83P probably benign Het
Vtn A G 11: 78,499,596 D53G possibly damaging Het
Vwde A T 6: 13,190,724 V456D probably damaging Het
Wdr91 G A 6: 34,884,308 P653L probably damaging Het
Ythdf1 G A 2: 180,911,492 A283V probably benign Het
Zfp975 C A 7: 42,662,949 W80L probably benign Het
Other mutations in Pde6b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Pde6b APN 5 108426571 splice site probably benign
IGL01071:Pde6b APN 5 108419715 nonsense probably null
IGL01335:Pde6b APN 5 108423513 missense probably benign 0.03
IGL01611:Pde6b APN 5 108403396 missense possibly damaging 0.90
IGL01881:Pde6b APN 5 108421500 missense probably benign 0.01
IGL01941:Pde6b APN 5 108423036 missense probably benign 0.11
IGL02616:Pde6b APN 5 108431541 missense probably benign 0.05
IGL02657:Pde6b APN 5 108420276 splice site probably benign
IGL03217:Pde6b APN 5 108419566 missense probably damaging 1.00
Bemr28 UTSW 5 unclassified
D4043:Pde6b UTSW 5 108425356 nonsense probably null
N/A:Pde6b UTSW 5 108429103 unclassified probably benign
PIT4362001:Pde6b UTSW 5 108423585 critical splice donor site probably null
PIT4581001:Pde6b UTSW 5 108428508 missense probably benign 0.01
R0940:Pde6b UTSW 5 108420337 missense possibly damaging 0.95
R0963:Pde6b UTSW 5 108430668 missense probably benign
R1753:Pde6b UTSW 5 108388691 nonsense probably null
R1801:Pde6b UTSW 5 108427847 missense possibly damaging 0.51
R1913:Pde6b UTSW 5 108427190 missense probably benign 0.05
R2131:Pde6b UTSW 5 108428203 missense probably damaging 1.00
R2282:Pde6b UTSW 5 108423586 splice site probably null
R3713:Pde6b UTSW 5 108423062 missense probably damaging 1.00
R4385:Pde6b UTSW 5 108427642 missense probably benign 0.08
R4562:Pde6b UTSW 5 108403368 missense probably benign 0.23
R4582:Pde6b UTSW 5 108425231 critical splice acceptor site probably null
R4939:Pde6b UTSW 5 108421497 missense probably benign 0.01
R4950:Pde6b UTSW 5 108430703 missense probably benign 0.16
R4972:Pde6b UTSW 5 108425264 missense probably benign 0.00
R4983:Pde6b UTSW 5 108425330 missense probably benign 0.21
R5056:Pde6b UTSW 5 108423491 nonsense probably null
R5514:Pde6b UTSW 5 108423451 missense probably benign 0.06
R5528:Pde6b UTSW 5 108423558 missense probably benign 0.04
R5937:Pde6b UTSW 5 108424327 missense probably benign 0.00
R6556:Pde6b UTSW 5 108421501 missense possibly damaging 0.56
R6826:Pde6b UTSW 5 108430592 nonsense probably null
R6884:Pde6b UTSW 5 108388708 missense probably damaging 0.99
R7213:Pde6b UTSW 5 108404090 missense probably damaging 1.00
R7444:Pde6b UTSW 5 108427142 nonsense probably null
R7690:Pde6b UTSW 5 108419518 missense not run
Predicted Primers PCR Primer
(F):5'- AGCTTATGCTGGGCCTCATTTCAC -3'
(R):5'- GAATTAGCTGCCTTGCTGCTTGC -3'

Sequencing Primer
(F):5'- TGACTTCTAAGATAAATATGCCACAG -3'
(R):5'- CATCTTACAGCATTGACTTAGGGG -3'
Posted On2014-05-23