Incidental Mutation 'R1738:Vwde'
ID199859
Institutional Source Beutler Lab
Gene Symbol Vwde
Ensembl Gene ENSMUSG00000079679
Gene Namevon Willebrand factor D and EGF domains
SynonymsLOC232585
MMRRC Submission 039770-MU
Accession Numbers

Genbank: NM_001013757; MGI: 2685313 

Is this an essential gene? Possibly non essential (E-score: 0.307) question?
Stock #R1738 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location13156299-13224965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 13190724 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 456 (V456D)
Ref Sequence ENSEMBL: ENSMUSP00000058110 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054530] [ENSMUST00000203074]
Predicted Effect probably damaging
Transcript: ENSMUST00000054530
AA Change: V456D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058110
Gene: ENSMUSG00000079679
AA Change: V456D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Blast:ZP 58 163 1e-5 BLAST
low complexity region 192 199 N/A INTRINSIC
VWD 420 588 1.51e-4 SMART
low complexity region 638 651 N/A INTRINSIC
Blast:EGF_like 890 918 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000203074
AA Change: V456D

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000145311
Gene: ENSMUSG00000079679
AA Change: V456D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 192 199 N/A INTRINSIC
VWD 420 588 7.4e-7 SMART
low complexity region 638 651 N/A INTRINSIC
EGF_like 890 918 1.5e-1 SMART
EGF 1166 1217 8.5e-6 SMART
EGF_like 1182 1233 2.7e-2 SMART
EGF 1222 1254 9.7e-7 SMART
EGF_CA 1256 1295 5.3e-12 SMART
EGF 1446 1483 5e-2 SMART
EGF 1485 1514 3.8e-3 SMART
EGF 1517 1546 3.6e-3 SMART
EGF 1549 1578 8e-7 SMART
EGF 1581 1610 3.4e-3 SMART
EGF 1613 1642 1.5e-3 SMART
EGF 1645 1674 1.1e-5 SMART
EGF 1677 1706 2.5e-4 SMART
EGF 1709 1738 2.5e-3 SMART
EGF 1741 1770 1.8e-2 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.7%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,611 Y202C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl3 T G 5: 81,387,979 M155R probably damaging Het
Ak9 A T 10: 41,335,921 Q218L possibly damaging Het
Akap13 G A 7: 75,677,194 G647D probably damaging Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Arhgap19 A G 19: 41,784,381 I291T probably benign Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
BC067074 T G 13: 113,367,500 L179R possibly damaging Het
Bsn T C 9: 108,106,934 D3307G unknown Het
Ces2h T A 8: 105,019,065 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a3 T C 1: 90,816,361 E88G probably damaging Het
Coro6 A G 11: 77,469,425 D407G probably benign Het
Cpe A T 8: 64,611,441 F241L probably damaging Het
Csde1 A G 3: 103,029,177 probably benign Het
Dgki A G 6: 37,057,432 I361T possibly damaging Het
Dnah3 A G 7: 120,035,359 V1298A probably damaging Het
Duox2 T A 2: 122,293,414 I430F probably damaging Het
Gak T C 5: 108,616,976 Y153C probably damaging Het
Gal3st2 T A 1: 93,874,596 probably null Het
Gbp11 T C 5: 105,326,644 N389D probably benign Het
Grm1 A G 10: 10,936,419 V287A probably damaging Het
Hsp90ab1 T C 17: 45,571,806 K36E probably damaging Het
Il24 T A 1: 130,887,362 probably null Het
Ino80d T C 1: 63,093,465 D13G probably damaging Het
Ipp G A 4: 116,530,421 V399I probably benign Het
Kank3 A T 17: 33,817,194 D12V probably damaging Het
Lcn12 A T 2: 25,493,251 S74R probably damaging Het
Mast3 T C 8: 70,784,556 T637A probably benign Het
Nes C A 3: 87,976,421 Y662* probably null Het
Nudt13 A T 14: 20,309,694 H163L probably damaging Het
Olfr1046 A T 2: 86,217,716 probably null Het
Olfr1178 G A 2: 88,391,327 V27I probably benign Het
Olfr1239 T C 2: 89,418,018 T132A probably benign Het
Olfr346 T C 2: 36,688,785 V261A probably benign Het
Pde6b C T 5: 108,430,559 R788* probably null Het
Pex13 A G 11: 23,649,458 L351P probably benign Het
Phc1 A G 6: 122,318,566 M942T probably damaging Het
Plch1 A T 3: 63,719,238 D571E probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhh2 A G 17: 84,566,697 N470S possibly damaging Het
Primpol A G 8: 46,607,838 S82P probably damaging Het
Prkg1 T C 19: 30,786,922 D256G possibly damaging Het
Prune2 A G 19: 17,125,010 E2511G probably benign Het
Rassf8 T C 6: 145,815,308 I120T probably benign Het
Rfx4 G A 10: 84,880,975 probably null Het
Rtp2 A T 16: 23,927,673 N69K probably benign Het
Sh3d19 A T 3: 86,120,606 I597F probably damaging Het
Sorl1 T A 9: 42,089,965 E246D probably benign Het
Spert C T 14: 75,593,057 M1I probably null Het
Tet2 T A 3: 133,481,387 I1094L probably benign Het
Tlr4 A T 4: 66,841,076 H702L probably benign Het
Tnfrsf14 T C 4: 154,925,331 D47G probably damaging Het
Ttn T C 2: 76,946,813 Y1415C probably damaging Het
Vmn2r17 T A 5: 109,428,511 F416Y probably benign Het
Vmn2r54 A G 7: 12,635,888 S83P probably benign Het
Vtn A G 11: 78,499,596 D53G possibly damaging Het
Wdr91 G A 6: 34,884,308 P653L probably damaging Het
Ythdf1 G A 2: 180,911,492 A283V probably benign Het
Zfp975 C A 7: 42,662,949 W80L probably benign Het
Other mutations in Vwde
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00725:Vwde APN 6 13187412 missense probably benign 0.00
IGL01391:Vwde APN 6 13190527 missense probably benign 0.07
IGL01432:Vwde APN 6 13193240 missense probably benign 0.18
IGL01611:Vwde APN 6 13219978 missense probably damaging 1.00
IGL01835:Vwde APN 6 13186824 missense probably benign 0.43
IGL01993:Vwde APN 6 13219978 missense possibly damaging 0.89
IGL01997:Vwde APN 6 13215706 missense probably damaging 1.00
IGL02390:Vwde APN 6 13190685 missense probably damaging 1.00
IGL02612:Vwde APN 6 13187149 missense probably damaging 1.00
IGL02723:Vwde APN 6 13205760 missense probably damaging 0.99
IGL02731:Vwde APN 6 13192614 missense probably damaging 1.00
IGL02869:Vwde APN 6 13187137 missense probably damaging 1.00
IGL02981:Vwde APN 6 13193113 missense possibly damaging 0.84
IGL03031:Vwde APN 6 13208382 missense probably benign 0.10
IGL03180:Vwde APN 6 13205765 missense probably damaging 1.00
IGL03182:Vwde APN 6 13187139 missense probably damaging 1.00
willy_brandt UTSW 6 13208405 splice site probably null
C9142:Vwde UTSW 6 13168054 splice site probably benign
R0089:Vwde UTSW 6 13220005 missense probably damaging 1.00
R0244:Vwde UTSW 6 13193126 missense probably benign 0.16
R0355:Vwde UTSW 6 13187807 splice site probably benign
R0455:Vwde UTSW 6 13187529 missense probably benign 0.03
R0465:Vwde UTSW 6 13215806 splice site probably benign
R0946:Vwde UTSW 6 13187875 missense probably damaging 1.00
R1087:Vwde UTSW 6 13186804 missense probably damaging 1.00
R1236:Vwde UTSW 6 13187153 nonsense probably null
R1891:Vwde UTSW 6 13187455 missense probably damaging 0.98
R2014:Vwde UTSW 6 13208338 missense possibly damaging 0.91
R2015:Vwde UTSW 6 13208338 missense possibly damaging 0.91
R2303:Vwde UTSW 6 13215807 splice site probably benign
R3439:Vwde UTSW 6 13208375 missense probably damaging 0.98
R3688:Vwde UTSW 6 13186892 missense probably damaging 0.96
R4457:Vwde UTSW 6 13196101 missense probably damaging 1.00
R4755:Vwde UTSW 6 13205852 missense possibly damaging 0.94
R4849:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4850:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4851:Vwde UTSW 6 13196048 missense possibly damaging 0.92
R4853:Vwde UTSW 6 13215640 missense probably damaging 1.00
R4951:Vwde UTSW 6 13187139 missense probably damaging 1.00
R5023:Vwde UTSW 6 13192642 missense possibly damaging 0.48
R5057:Vwde UTSW 6 13192642 missense possibly damaging 0.48
R5060:Vwde UTSW 6 13208324 splice site probably null
R5126:Vwde UTSW 6 13187260 missense probably benign 0.04
R5154:Vwde UTSW 6 13215758 missense probably benign 0.01
R5277:Vwde UTSW 6 13186996 missense probably benign 0.03
R5432:Vwde UTSW 6 13190592 missense probably damaging 1.00
R5436:Vwde UTSW 6 13190628 missense probably damaging 1.00
R5472:Vwde UTSW 6 13193118 missense probably benign 0.00
R5518:Vwde UTSW 6 13186938 missense probably benign 0.00
R5791:Vwde UTSW 6 13195986 nonsense probably null
R6045:Vwde UTSW 6 13219936 missense probably damaging 1.00
R6262:Vwde UTSW 6 13205021 missense probably damaging 1.00
R6482:Vwde UTSW 6 13205844 missense probably damaging 1.00
R6500:Vwde UTSW 6 13208405 splice site probably null
R6562:Vwde UTSW 6 13193123 missense possibly damaging 0.84
R6905:Vwde UTSW 6 13205927 missense probably damaging 1.00
R7021:Vwde UTSW 6 13186906 missense probably damaging 1.00
R7103:Vwde UTSW 6 13215800 missense probably benign 0.03
R7356:Vwde UTSW 6 13192642 missense probably damaging 0.96
R7434:Vwde UTSW 6 13187640 missense probably benign 0.00
R7492:Vwde UTSW 6 13204981 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ATGACGGGGATTCATGTAACTGGC -3'
(R):5'- GTGTACTCAGCAAGCAGATTCTCCTTT -3'

Sequencing Primer
(F):5'- GGCCACTGCACATATCAAAAG -3'
(R):5'- TCTCCTTTAAGAGTGAAGCCAGC -3'
Posted On2014-05-23