Incidental Mutation 'R0087:Pdgfrb'
ID19986
Institutional Source Beutler Lab
Gene Symbol Pdgfrb
Ensembl Gene ENSMUSG00000024620
Gene Nameplatelet derived growth factor receptor, beta polypeptide
SynonymsCD140b, Pdgfr
MMRRC Submission 038374-MU
Accession Numbers

Ncbi RefSeq: NM_001146268.1, NM_008809.2; MGI:97531

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0087 (G1)
Quality Score225
Status Validated (trace)
Chromosome18
Chromosomal Location61045150-61085061 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61061513 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 121 (I121F)
Ref Sequence ENSEMBL: ENSMUSP00000110929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025522] [ENSMUST00000115274]
Predicted Effect probably damaging
Transcript: ENSMUST00000025522
AA Change: I117F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000025522
Gene: ENSMUSG00000024620
AA Change: I117F

DomainStartEndE-ValueType
low complexity region 10 24 N/A INTRINSIC
IG 38 120 5.58e-2 SMART
IGc2 225 297 2.83e-12 SMART
IG_like 330 402 1.47e0 SMART
Pfam:Ig_2 415 524 5.6e-2 PFAM
transmembrane domain 534 556 N/A INTRINSIC
TyrKc 600 958 1.11e-135 SMART
low complexity region 1063 1083 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115274
AA Change: I121F

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110929
Gene: ENSMUSG00000024620
AA Change: I121F

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
IG 42 124 5.58e-2 SMART
IGc2 229 301 2.83e-12 SMART
IG_like 334 406 1.47e0 SMART
transmembrane domain 538 560 N/A INTRINSIC
TyrKc 604 962 1.11e-135 SMART
low complexity region 1067 1087 N/A INTRINSIC
Meta Mutation Damage Score 0.1461 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.5%
  • 20x: 82.3%
Validation Efficiency 86% (59/69)
MGI Phenotype Strain: 2682393; 2135508
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. This gene is flanked on chromosome 5 by the genes for granulocyte-macrophage colony-stimulating factor and macrophage-colony stimulating factor receptor; all three genes may be implicated in the 5-q syndrome. A translocation between chromosomes 5 and 12, that fuses this gene to that of the translocation, ETV6, leukemia gene, results in chronic myeloproliferative disorder with eosinophilia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die perinatally with internal bleeding, thrombocytopenia, anemia and kidney defects. A frameshift mutation results in neonatal lethals with edema and hemorrhaging; several point mutations show cardiovascular abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(25) : Targeted(23) Gene trapped(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Adgrv1 T A 13: 81,386,951 I5732F probably damaging Het
Adss A T 1: 177,771,222 V330E probably benign Het
Agps T A 2: 75,909,635 Y488N probably damaging Het
Ap3s1 A T 18: 46,758,039 R66S probably damaging Het
Ass1 A T 2: 31,514,819 N371Y probably damaging Het
Atp2a2 C T 5: 122,460,961 V593I probably benign Het
Chrna6 C T 8: 27,406,986 V288M probably damaging Het
Col4a2 C T 8: 11,441,296 L1232F probably benign Het
Dcaf1 A G 9: 106,863,089 N1225D probably damaging Het
Degs1 A G 1: 182,279,310 I128T probably benign Het
Dnah5 A T 15: 28,350,613 T2594S probably damaging Het
Dnah8 G T 17: 30,755,119 R2826L probably damaging Het
Elf3 A G 1: 135,257,137 Y104H probably damaging Het
Fam222b C A 11: 78,153,892 T93N probably benign Het
Fbxw26 A G 9: 109,724,938 I211T probably benign Het
Fcho2 T C 13: 98,735,086 T541A probably benign Het
Flg2 T C 3: 93,202,431 S589P unknown Het
Foxj3 T A 4: 119,626,400 V589E unknown Het
Gria1 A G 11: 57,317,712 Y742C probably damaging Het
Inpp5d T C 1: 87,715,138 S672P probably damaging Het
Lrrc19 A C 4: 94,640,772 F91C probably damaging Het
Lrrc6 T C 15: 66,469,975 T91A probably benign Het
Mppe1 A G 18: 67,225,704 *398R probably null Het
Mroh3 T C 1: 136,190,803 I561V probably benign Het
Myh11 C A 16: 14,224,019 Q720H probably damaging Het
Nbea G T 3: 56,091,023 T121K possibly damaging Het
Nbr1 A C 11: 101,564,693 D91A probably benign Het
Ncam2 C A 16: 81,434,901 N84K probably benign Het
Olfr1260 T C 2: 89,978,131 Y118H probably damaging Het
Olfr616 A T 7: 103,564,362 C306S probably benign Het
Olfr618 A G 7: 103,597,721 Y135C probably benign Het
Olfr651 A G 7: 104,553,662 I248V possibly damaging Het
Olfr711 A G 7: 106,972,116 V76A probably benign Het
Peak1 A T 9: 56,258,325 I773N probably damaging Het
Pfkfb4 G T 9: 109,007,701 V155F probably damaging Het
Pkm C T 9: 59,678,099 R455* probably null Het
Plbd2 C A 5: 120,494,485 E151* probably null Het
Pld5 G A 1: 175,984,459 T353M probably damaging Het
Psme2b A T 11: 48,945,717 D134E possibly damaging Het
Rida T A 15: 34,488,626 D40V possibly damaging Het
Rnf126 A T 10: 79,759,234 H265Q probably damaging Het
Rock2 C A 12: 16,928,966 Q86K probably benign Het
Serpinb1b A T 13: 33,085,319 T12S probably benign Het
Slco6c1 T A 1: 97,118,578 Q277L probably benign Het
Sptlc2 T A 12: 87,369,118 H45L probably benign Het
Srsf4 A G 4: 131,900,330 probably benign Het
Sspo A G 6: 48,477,785 S2969G probably damaging Het
Steap1 C T 5: 5,736,664 G258R probably damaging Het
Stk19 A T 17: 34,836,875 M1K probably null Het
Stk-ps2 C A 1: 46,029,889 noncoding transcript Het
Taf1c C T 8: 119,600,987 R332H probably damaging Het
Thbs4 T A 13: 92,755,235 T791S probably damaging Het
Theg A T 10: 79,585,951 Y144* probably null Het
Tjap1 A G 17: 46,263,726 L21P probably damaging Het
Tmem145 A G 7: 25,307,843 Y148C probably damaging Het
Tmem267 T A 13: 119,609,274 V155E probably benign Het
Tns1 T A 1: 73,916,917 H549L possibly damaging Het
Tyro3 T G 2: 119,801,701 I83S probably benign Het
Ubxn4 G A 1: 128,262,904 E256K probably benign Het
Vmn1r53 A T 6: 90,223,431 C304S probably benign Het
Vwf G A 6: 125,645,954 M1761I probably benign Het
Zfp276 T C 8: 123,265,047 Y445H probably damaging Het
Zfp407 A T 18: 84,560,411 I859N probably damaging Het
Other mutations in Pdgfrb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Pdgfrb APN 18 61068936 missense probably benign 0.20
IGL01396:Pdgfrb APN 18 61072664 missense probably damaging 1.00
IGL02377:Pdgfrb APN 18 61080332 missense probably damaging 1.00
IGL02435:Pdgfrb APN 18 61064926 critical splice donor site probably null
IGL03397:Pdgfrb APN 18 61079681 missense probably benign 0.28
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0021:Pdgfrb UTSW 18 61064926 critical splice donor site probably benign
R0119:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0299:Pdgfrb UTSW 18 61068852 missense probably benign 0.06
R0532:Pdgfrb UTSW 18 61083265 missense probably damaging 1.00
R0570:Pdgfrb UTSW 18 61077703 missense probably benign 0.00
R0629:Pdgfrb UTSW 18 61078648 critical splice donor site probably null
R0650:Pdgfrb UTSW 18 61079708 missense probably benign 0.00
R0853:Pdgfrb UTSW 18 61080327 missense probably damaging 1.00
R1165:Pdgfrb UTSW 18 61064002 missense probably benign 0.01
R1342:Pdgfrb UTSW 18 61065880 nonsense probably null
R1740:Pdgfrb UTSW 18 61081833 missense possibly damaging 0.93
R1808:Pdgfrb UTSW 18 61068102 missense probably benign
R1864:Pdgfrb UTSW 18 61071717 missense probably benign 0.00
R1960:Pdgfrb UTSW 18 61065783 missense probably benign 0.05
R1961:Pdgfrb UTSW 18 61061505 missense possibly damaging 0.49
R1970:Pdgfrb UTSW 18 61066494 splice site probably benign
R2011:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2012:Pdgfrb UTSW 18 61061494 missense probably benign 0.01
R2018:Pdgfrb UTSW 18 61083334 missense possibly damaging 0.84
R2153:Pdgfrb UTSW 18 61072756 missense probably damaging 1.00
R2497:Pdgfrb UTSW 18 61078628 missense possibly damaging 0.58
R2846:Pdgfrb UTSW 18 61064016 missense probably benign 0.00
R3776:Pdgfrb UTSW 18 61081920 missense probably benign 0.00
R3779:Pdgfrb UTSW 18 61072666 missense probably damaging 1.00
R3816:Pdgfrb UTSW 18 61078945 missense probably damaging 1.00
R3978:Pdgfrb UTSW 18 61073685 missense probably damaging 1.00
R4259:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4261:Pdgfrb UTSW 18 61077631 missense probably benign 0.00
R4327:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4329:Pdgfrb UTSW 18 61071720 missense possibly damaging 0.83
R4598:Pdgfrb UTSW 18 61068757 missense probably benign 0.03
R4668:Pdgfrb UTSW 18 61064113 missense probably damaging 1.00
R4761:Pdgfrb UTSW 18 61079700 missense probably damaging 1.00
R4787:Pdgfrb UTSW 18 61079687 missense probably damaging 1.00
R4828:Pdgfrb UTSW 18 61073243 missense probably damaging 0.98
R5030:Pdgfrb UTSW 18 61065135 missense probably benign 0.13
R5033:Pdgfrb UTSW 18 61077668 missense probably damaging 1.00
R5447:Pdgfrb UTSW 18 61068108 missense probably damaging 1.00
R6224:Pdgfrb UTSW 18 61081939 nonsense probably null
R6807:Pdgfrb UTSW 18 61078649 critical splice donor site probably null
R6858:Pdgfrb UTSW 18 61065147 missense probably benign 0.01
R7017:Pdgfrb UTSW 18 61081004 missense probably benign 0.00
R7089:Pdgfrb UTSW 18 61073243 missense probably damaging 1.00
R7174:Pdgfrb UTSW 18 61066515 missense probably benign
R7374:Pdgfrb UTSW 18 61071708 missense possibly damaging 0.64
R7496:Pdgfrb UTSW 18 61078932 missense possibly damaging 0.71
R7565:Pdgfrb UTSW 18 61083264 missense probably damaging 1.00
R7615:Pdgfrb UTSW 18 61064046 missense probably benign 0.00
R7691:Pdgfrb UTSW 18 61061268 missense probably benign 0.05
R7884:Pdgfrb UTSW 18 61072658 missense probably damaging 1.00
R8481:Pdgfrb UTSW 18 61065742 missense probably benign 0.03
R8735:Pdgfrb UTSW 18 61063977 missense probably benign 0.26
R8737:Pdgfrb UTSW 18 61081001 missense probably damaging 1.00
X0060:Pdgfrb UTSW 18 61081976 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGATGTGGGAACAGATGTCCCAG -3'
(R):5'- TCATTCGATGCTGACAGGGCTG -3'

Sequencing Primer
(F):5'- GGTGCCCTGGCAAGAAG -3'
(R):5'- TTCTTGGAAGGCGAGATCAG -3'
Posted On2013-04-11