Incidental Mutation 'R1738:Mast3'
ID 199873
Institutional Source Beutler Lab
Gene Symbol Mast3
Ensembl Gene ENSMUSG00000031833
Gene Name microtubule associated serine/threonine kinase 3
Synonyms
MMRRC Submission 039770-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1738 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 71230761-71257681 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 71237200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 637 (T637A)
Ref Sequence ENSEMBL: ENSMUSP00000128703 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]
AlphaFold Q3U214
Predicted Effect probably benign
Transcript: ENSMUST00000166004
AA Change: T637A

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: T637A

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DUF1908 64 337 4.4e-128 PFAM
S_TKc 373 646 2.77e-99 SMART
S_TK_X 647 710 2.39e-1 SMART
low complexity region 820 833 N/A INTRINSIC
low complexity region 910 942 N/A INTRINSIC
PDZ 958 1038 3.8e-15 SMART
low complexity region 1053 1074 N/A INTRINSIC
low complexity region 1089 1121 N/A INTRINSIC
low complexity region 1124 1150 N/A INTRINSIC
low complexity region 1180 1204 N/A INTRINSIC
low complexity region 1231 1248 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211841
Predicted Effect probably benign
Transcript: ENSMUST00000211948
AA Change: T621A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000212038
Predicted Effect probably benign
Transcript: ENSMUST00000212140
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212172
Predicted Effect probably benign
Transcript: ENSMUST00000212551
Predicted Effect probably benign
Transcript: ENSMUST00000212673
Predicted Effect probably benign
Transcript: ENSMUST00000212757
Predicted Effect probably benign
Transcript: ENSMUST00000212875
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.7%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,682,475 (GRCm39) Y202C probably damaging Het
Adamts16 G A 13: 70,927,637 (GRCm39) probably benign Het
Adgrl3 T G 5: 81,535,826 (GRCm39) M155R probably damaging Het
Ak9 A T 10: 41,211,917 (GRCm39) Q218L possibly damaging Het
Akap13 G A 7: 75,326,942 (GRCm39) G647D probably damaging Het
Angptl3 A G 4: 98,921,499 (GRCm39) T206A probably benign Het
Arhgap19 A G 19: 41,772,820 (GRCm39) I291T probably benign Het
BC049715 C T 6: 136,817,306 (GRCm39) P182L probably damaging Het
Bsn T C 9: 107,984,133 (GRCm39) D3307G unknown Het
Cby2 C T 14: 75,830,497 (GRCm39) M1I probably null Het
Ces2h T A 8: 105,745,697 (GRCm39) probably null Het
Ces4a G A 8: 105,864,729 (GRCm39) G69S probably damaging Het
Col4a2 T A 8: 11,496,238 (GRCm39) F1620I probably damaging Het
Col6a3 T C 1: 90,744,083 (GRCm39) E88G probably damaging Het
Coro6 A G 11: 77,360,251 (GRCm39) D407G probably benign Het
Cpe A T 8: 65,064,475 (GRCm39) F241L probably damaging Het
Csde1 A G 3: 102,936,493 (GRCm39) probably benign Het
Cspg4b T G 13: 113,504,034 (GRCm39) L179R possibly damaging Het
Dgki A G 6: 37,034,367 (GRCm39) I361T possibly damaging Het
Dnah3 A G 7: 119,634,582 (GRCm39) V1298A probably damaging Het
Duox2 T A 2: 122,123,895 (GRCm39) I430F probably damaging Het
Gak T C 5: 108,764,842 (GRCm39) Y153C probably damaging Het
Gal3st2 T A 1: 93,802,318 (GRCm39) probably null Het
Gbp11 T C 5: 105,474,510 (GRCm39) N389D probably benign Het
Grm1 A G 10: 10,812,163 (GRCm39) V287A probably damaging Het
Hsp90ab1 T C 17: 45,882,732 (GRCm39) K36E probably damaging Het
Il24 T A 1: 130,815,099 (GRCm39) probably null Het
Ino80d T C 1: 63,132,624 (GRCm39) D13G probably damaging Het
Ipp G A 4: 116,387,618 (GRCm39) V399I probably benign Het
Kank3 A T 17: 34,036,168 (GRCm39) D12V probably damaging Het
Lcn12 A T 2: 25,383,263 (GRCm39) S74R probably damaging Het
Nes C A 3: 87,883,728 (GRCm39) Y662* probably null Het
Nudt13 A T 14: 20,359,762 (GRCm39) H163L probably damaging Het
Or1j17 T C 2: 36,578,797 (GRCm39) V261A probably benign Het
Or4a2 T C 2: 89,248,362 (GRCm39) T132A probably benign Het
Or4p7 G A 2: 88,221,671 (GRCm39) V27I probably benign Het
Or8k1 A T 2: 86,048,060 (GRCm39) probably null Het
Pde6b C T 5: 108,578,425 (GRCm39) R788* probably null Het
Pex13 A G 11: 23,599,458 (GRCm39) L351P probably benign Het
Phc1 A G 6: 122,295,525 (GRCm39) M942T probably damaging Het
Plch1 A T 3: 63,626,659 (GRCm39) D571E probably benign Het
Plec C T 15: 76,070,418 (GRCm39) V931M probably damaging Het
Plekhh2 A G 17: 84,874,125 (GRCm39) N470S possibly damaging Het
Primpol A G 8: 47,060,873 (GRCm39) S82P probably damaging Het
Prkg1 T C 19: 30,764,322 (GRCm39) D256G possibly damaging Het
Prune2 A G 19: 17,102,374 (GRCm39) E2511G probably benign Het
Rassf8 T C 6: 145,761,034 (GRCm39) I120T probably benign Het
Rfx4 G A 10: 84,716,839 (GRCm39) probably null Het
Rtp2 A T 16: 23,746,423 (GRCm39) N69K probably benign Het
Sh3d19 A T 3: 86,027,913 (GRCm39) I597F probably damaging Het
Sorl1 T A 9: 42,001,261 (GRCm39) E246D probably benign Het
Tet2 T A 3: 133,187,148 (GRCm39) I1094L probably benign Het
Tlr4 A T 4: 66,759,313 (GRCm39) H702L probably benign Het
Tnfrsf14 T C 4: 155,009,788 (GRCm39) D47G probably damaging Het
Ttn T C 2: 76,777,157 (GRCm39) Y1415C probably damaging Het
Vmn2r17 T A 5: 109,576,377 (GRCm39) F416Y probably benign Het
Vmn2r54 A G 7: 12,369,815 (GRCm39) S83P probably benign Het
Vtn A G 11: 78,390,422 (GRCm39) D53G possibly damaging Het
Vwde A T 6: 13,190,723 (GRCm39) V456D probably damaging Het
Wdr91 G A 6: 34,861,243 (GRCm39) P653L probably damaging Het
Ythdf1 G A 2: 180,553,285 (GRCm39) A283V probably benign Het
Zfp975 C A 7: 42,312,373 (GRCm39) W80L probably benign Het
Other mutations in Mast3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Mast3 APN 8 71,233,327 (GRCm39) splice site probably benign
IGL01411:Mast3 APN 8 71,232,227 (GRCm39) missense possibly damaging 0.50
IGL01475:Mast3 APN 8 71,232,174 (GRCm39) missense probably damaging 1.00
IGL01886:Mast3 APN 8 71,234,783 (GRCm39) missense possibly damaging 0.94
IGL02104:Mast3 APN 8 71,240,550 (GRCm39) missense possibly damaging 0.78
IGL02236:Mast3 APN 8 71,241,888 (GRCm39) missense probably benign 0.36
IGL02437:Mast3 APN 8 71,233,202 (GRCm39) missense possibly damaging 0.79
IGL02704:Mast3 APN 8 71,239,519 (GRCm39) missense probably damaging 1.00
IGL03155:Mast3 APN 8 71,241,861 (GRCm39) missense probably damaging 1.00
IGL03366:Mast3 APN 8 71,234,207 (GRCm39) nonsense probably null
gravy UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
stuffing UTSW 8 71,237,441 (GRCm39) frame shift probably null
turkey UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
BB010:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
BB020:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R0037:Mast3 UTSW 8 71,236,343 (GRCm39) critical splice donor site probably null
R0280:Mast3 UTSW 8 71,240,564 (GRCm39) missense possibly damaging 0.65
R0280:Mast3 UTSW 8 71,236,439 (GRCm39) missense probably damaging 1.00
R0731:Mast3 UTSW 8 71,233,965 (GRCm39) missense probably damaging 1.00
R1101:Mast3 UTSW 8 71,239,307 (GRCm39) missense probably damaging 1.00
R1177:Mast3 UTSW 8 71,232,968 (GRCm39) missense probably damaging 1.00
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1208:Mast3 UTSW 8 71,240,916 (GRCm39) splice site probably null
R1333:Mast3 UTSW 8 71,233,938 (GRCm39) missense probably damaging 1.00
R1543:Mast3 UTSW 8 71,244,955 (GRCm39) missense possibly damaging 0.93
R1544:Mast3 UTSW 8 71,238,816 (GRCm39) missense probably damaging 1.00
R1842:Mast3 UTSW 8 71,233,037 (GRCm39) missense possibly damaging 0.91
R1936:Mast3 UTSW 8 71,237,444 (GRCm39) missense probably damaging 1.00
R2015:Mast3 UTSW 8 71,240,007 (GRCm39) missense probably benign 0.00
R2219:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R2220:Mast3 UTSW 8 71,233,607 (GRCm39) missense probably damaging 0.99
R3711:Mast3 UTSW 8 71,232,251 (GRCm39) missense probably benign 0.13
R3919:Mast3 UTSW 8 71,232,066 (GRCm39) missense probably benign 0.02
R4027:Mast3 UTSW 8 71,240,552 (GRCm39) missense probably damaging 1.00
R4060:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4061:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4062:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4063:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R4588:Mast3 UTSW 8 71,233,251 (GRCm39) nonsense probably null
R4672:Mast3 UTSW 8 71,237,441 (GRCm39) frame shift probably null
R4770:Mast3 UTSW 8 71,238,864 (GRCm39) missense probably damaging 1.00
R4822:Mast3 UTSW 8 71,233,010 (GRCm39) missense probably damaging 1.00
R4830:Mast3 UTSW 8 71,241,559 (GRCm39) missense possibly damaging 0.87
R5196:Mast3 UTSW 8 71,240,889 (GRCm39) missense probably damaging 1.00
R5333:Mast3 UTSW 8 71,236,145 (GRCm39) missense probably benign 0.03
R5428:Mast3 UTSW 8 71,237,377 (GRCm39) missense possibly damaging 0.95
R5656:Mast3 UTSW 8 71,238,865 (GRCm39) missense probably damaging 1.00
R5920:Mast3 UTSW 8 71,240,577 (GRCm39) missense probably benign 0.00
R6177:Mast3 UTSW 8 71,242,662 (GRCm39) missense probably damaging 1.00
R6186:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
R6407:Mast3 UTSW 8 71,234,772 (GRCm39) missense probably benign 0.02
R6614:Mast3 UTSW 8 71,234,610 (GRCm39) missense possibly damaging 0.95
R6804:Mast3 UTSW 8 71,239,376 (GRCm39) missense probably benign 0.29
R6873:Mast3 UTSW 8 71,239,236 (GRCm39) nonsense probably null
R6930:Mast3 UTSW 8 71,252,115 (GRCm39) nonsense probably null
R6948:Mast3 UTSW 8 71,238,126 (GRCm39) missense probably damaging 1.00
R7084:Mast3 UTSW 8 71,232,117 (GRCm39) missense probably benign 0.14
R7253:Mast3 UTSW 8 71,242,326 (GRCm39) critical splice donor site probably null
R7316:Mast3 UTSW 8 71,232,432 (GRCm39) missense probably damaging 1.00
R7357:Mast3 UTSW 8 71,237,503 (GRCm39) missense probably damaging 1.00
R7405:Mast3 UTSW 8 71,238,815 (GRCm39) missense probably damaging 1.00
R7429:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7430:Mast3 UTSW 8 71,232,947 (GRCm39) missense probably damaging 1.00
R7521:Mast3 UTSW 8 71,241,412 (GRCm39) missense probably benign 0.16
R7576:Mast3 UTSW 8 71,233,838 (GRCm39) missense probably damaging 1.00
R7933:Mast3 UTSW 8 71,239,279 (GRCm39) missense probably damaging 1.00
R7998:Mast3 UTSW 8 71,236,214 (GRCm39) missense probably benign
R8021:Mast3 UTSW 8 71,240,896 (GRCm39) missense probably benign 0.02
R8204:Mast3 UTSW 8 71,240,925 (GRCm39) missense probably benign 0.00
R8327:Mast3 UTSW 8 71,232,062 (GRCm39) missense probably damaging 1.00
R8357:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8415:Mast3 UTSW 8 71,233,866 (GRCm39) missense probably damaging 1.00
R8457:Mast3 UTSW 8 71,233,085 (GRCm39) missense probably benign 0.39
R8530:Mast3 UTSW 8 71,240,877 (GRCm39) missense possibly damaging 0.92
R8891:Mast3 UTSW 8 71,233,801 (GRCm39) missense probably damaging 1.00
R8930:Mast3 UTSW 8 71,234,377 (GRCm39) splice site probably benign
R9002:Mast3 UTSW 8 71,233,904 (GRCm39) missense probably damaging 1.00
R9085:Mast3 UTSW 8 71,249,361 (GRCm39) missense unknown
R9087:Mast3 UTSW 8 71,242,330 (GRCm39) missense possibly damaging 0.93
R9148:Mast3 UTSW 8 71,233,091 (GRCm39) missense probably damaging 0.98
R9364:Mast3 UTSW 8 71,238,826 (GRCm39) missense probably damaging 1.00
R9779:Mast3 UTSW 8 71,238,127 (GRCm39) missense probably damaging 1.00
Z1177:Mast3 UTSW 8 71,241,682 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GCTTCAAGCTGTGGGACAAACTCTG -3'
(R):5'- AAGGGTCTGAGGTGACCACAATGC -3'

Sequencing Primer
(F):5'- TTTCCCACTGAATGGAGCCAG -3'
(R):5'- GGTGACCACAATGCTACCTC -3'
Posted On 2014-05-23