Mutagenetix > Incidental Mutation

Incidental Mutation 'R1738:Mast3'

199873

Institutional Source

Beutler Lab

Gene Symbol

Mast3

Ensembl Gene

ENSMUSG00000031833

Gene Name

microtubule associated serine/threonine kinase 3

Synonyms

MMRRC Submission

039770-MU

Accession Numbers

Ncbi RefSeq: NM_199308.2. MGI:2683541

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1738 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

70778117-70805054 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 70784556 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 637 (T637A)

Ref Sequence

ENSEMBL: ENSMUSP00000128703 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166004] [ENSMUST00000211948] [ENSMUST00000212038] [ENSMUST00000212551] [ENSMUST00000212673] [ENSMUST00000212757] [ENSMUST00000212875]

AlphaFold

Q3U214

Predicted Effect

probably benign
Transcript: ENSMUST00000166004
AA Change: T637A

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000128703
Gene: ENSMUSG00000031833
AA Change: T637A

Domain	Start	End	E-Value	Type
low complexity region	43	59	N/A	INTRINSIC
Pfam:DUF1908	64	337	4.4e-128	PFAM
S_TKc	373	646	2.77e-99	SMART
S_TK_X	647	710	2.39e-1	SMART
low complexity region	820	833	N/A	INTRINSIC
low complexity region	910	942	N/A	INTRINSIC
PDZ	958	1038	3.8e-15	SMART
low complexity region	1053	1074	N/A	INTRINSIC
low complexity region	1089	1121	N/A	INTRINSIC
low complexity region	1124	1150	N/A	INTRINSIC
low complexity region	1180	1204	N/A	INTRINSIC
low complexity region	1231	1248	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000211841

Predicted Effect

probably benign
Transcript: ENSMUST00000211948
AA Change: T621A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

Predicted Effect

probably benign
Transcript: ENSMUST00000212038

Predicted Effect

probably benign
Transcript: ENSMUST00000212140

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212172

Predicted Effect

probably benign
Transcript: ENSMUST00000212551

Predicted Effect

probably benign
Transcript: ENSMUST00000212673

Predicted Effect

probably benign
Transcript: ENSMUST00000212757

Predicted Effect

probably benign
Transcript: ENSMUST00000212875

Coding Region Coverage

1x: 97.5%
3x: 96.8%
10x: 94.7%
20x: 89.9%

Validation Efficiency

Allele List at MGI

All alleles(2) : Targeted(1) Gene trapped(1)

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930562C15Rik	A	G	16: 4,864,611	Y202C	probably damaging	Het
Adamts16	G	A	13: 70,779,518		probably benign	Het
Adgrl3	T	G	5: 81,387,979	M155R	probably damaging	Het
Ak9	A	T	10: 41,335,921	Q218L	possibly damaging	Het
Akap13	G	A	7: 75,677,194	G647D	probably damaging	Het
Angptl3	A	G	4: 99,033,262	T206A	probably benign	Het
Arhgap19	A	G	19: 41,784,381	I291T	probably benign	Het
BC049715	C	T	6: 136,840,308	P182L	probably damaging	Het
BC067074	T	G	13: 113,367,500	L179R	possibly damaging	Het
Bsn	T	C	9: 108,106,934	D3307G	unknown	Het
Ces2h	T	A	8: 105,019,065		probably null	Het
Ces4a	G	A	8: 105,138,097	G69S	probably damaging	Het
Col4a2	T	A	8: 11,446,238	F1620I	probably damaging	Het
Col6a3	T	C	1: 90,816,361	E88G	probably damaging	Het
Coro6	A	G	11: 77,469,425	D407G	probably benign	Het
Cpe	A	T	8: 64,611,441	F241L	probably damaging	Het
Csde1	A	G	3: 103,029,177		probably benign	Het
Dgki	A	G	6: 37,057,432	I361T	possibly damaging	Het
Dnah3	A	G	7: 120,035,359	V1298A	probably damaging	Het
Duox2	T	A	2: 122,293,414	I430F	probably damaging	Het
Gak	T	C	5: 108,616,976	Y153C	probably damaging	Het
Gal3st2	T	A	1: 93,874,596		probably null	Het
Gbp11	T	C	5: 105,326,644	N389D	probably benign	Het
Grm1	A	G	10: 10,936,419	V287A	probably damaging	Het
Hsp90ab1	T	C	17: 45,571,806	K36E	probably damaging	Het
Il24	T	A	1: 130,887,362		probably null	Het
Ino80d	T	C	1: 63,093,465	D13G	probably damaging	Het
Ipp	G	A	4: 116,530,421	V399I	probably benign	Het
Kank3	A	T	17: 33,817,194	D12V	probably damaging	Het
Lcn12	A	T	2: 25,493,251	S74R	probably damaging	Het
Nes	C	A	3: 87,976,421	Y662*	probably null	Het
Nudt13	A	T	14: 20,309,694	H163L	probably damaging	Het
Olfr1046	A	T	2: 86,217,716		probably null	Het
Olfr1178	G	A	2: 88,391,327	V27I	probably benign	Het
Olfr1239	T	C	2: 89,418,018	T132A	probably benign	Het
Olfr346	T	C	2: 36,688,785	V261A	probably benign	Het
Pde6b	C	T	5: 108,430,559	R788*	probably null	Het
Pex13	A	G	11: 23,649,458	L351P	probably benign	Het
Phc1	A	G	6: 122,318,566	M942T	probably damaging	Het
Plch1	A	T	3: 63,719,238	D571E	probably benign	Het
Plec	C	T	15: 76,186,218	V931M	probably damaging	Het
Plekhh2	A	G	17: 84,566,697	N470S	possibly damaging	Het
Primpol	A	G	8: 46,607,838	S82P	probably damaging	Het
Prkg1	T	C	19: 30,786,922	D256G	possibly damaging	Het
Prune2	A	G	19: 17,125,010	E2511G	probably benign	Het
Rassf8	T	C	6: 145,815,308	I120T	probably benign	Het
Rfx4	G	A	10: 84,880,975		probably null	Het
Rtp2	A	T	16: 23,927,673	N69K	probably benign	Het
Sh3d19	A	T	3: 86,120,606	I597F	probably damaging	Het
Sorl1	T	A	9: 42,089,965	E246D	probably benign	Het
Spert	C	T	14: 75,593,057	M1I	probably null	Het
Tet2	T	A	3: 133,481,387	I1094L	probably benign	Het
Tlr4	A	T	4: 66,841,076	H702L	probably benign	Het
Tnfrsf14	T	C	4: 154,925,331	D47G	probably damaging	Het
Ttn	T	C	2: 76,946,813	Y1415C	probably damaging	Het
Vmn2r17	T	A	5: 109,428,511	F416Y	probably benign	Het
Vmn2r54	A	G	7: 12,635,888	S83P	probably benign	Het
Vtn	A	G	11: 78,499,596	D53G	possibly damaging	Het
Vwde	A	T	6: 13,190,724	V456D	probably damaging	Het
Wdr91	G	A	6: 34,884,308	P653L	probably damaging	Het
Ythdf1	G	A	2: 180,911,492	A283V	probably benign	Het
Zfp975	C	A	7: 42,662,949	W80L	probably benign	Het

Other mutations in Mast3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00952:Mast3	APN	8	70780683	splice site	probably benign
IGL01411:Mast3	APN	8	70779583	missense	possibly damaging	0.50
IGL01475:Mast3	APN	8	70779530	missense	probably damaging	1.00
IGL01886:Mast3	APN	8	70782139	missense	possibly damaging	0.94
IGL02104:Mast3	APN	8	70787906	missense	possibly damaging	0.78
IGL02236:Mast3	APN	8	70789244	missense	probably benign	0.36
IGL02437:Mast3	APN	8	70780558	missense	possibly damaging	0.79
IGL02704:Mast3	APN	8	70786875	missense	probably damaging	1.00
IGL03155:Mast3	APN	8	70789217	missense	probably damaging	1.00
IGL03366:Mast3	APN	8	70781563	nonsense	probably null
gravy	UTSW	8	70786635	missense	probably damaging	1.00
stuffing	UTSW	8	70784797	frame shift	probably null
turkey	UTSW	8	70785482	missense	probably damaging	1.00
BB010:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
BB020:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R0037:Mast3	UTSW	8	70783699	critical splice donor site	probably null
R0280:Mast3	UTSW	8	70783795	missense	probably damaging	1.00
R0280:Mast3	UTSW	8	70787920	missense	possibly damaging	0.65
R0731:Mast3	UTSW	8	70781321	missense	probably damaging	1.00
R1101:Mast3	UTSW	8	70786663	missense	probably damaging	1.00
R1177:Mast3	UTSW	8	70780324	missense	probably damaging	1.00
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1208:Mast3	UTSW	8	70788272	splice site	probably null
R1333:Mast3	UTSW	8	70781294	missense	probably damaging	1.00
R1543:Mast3	UTSW	8	70792311	missense	possibly damaging	0.93
R1544:Mast3	UTSW	8	70786172	missense	probably damaging	1.00
R1842:Mast3	UTSW	8	70780393	missense	possibly damaging	0.91
R1936:Mast3	UTSW	8	70784800	missense	probably damaging	1.00
R2015:Mast3	UTSW	8	70787363	missense	probably benign	0.00
R2219:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R2220:Mast3	UTSW	8	70780963	missense	probably damaging	0.99
R3711:Mast3	UTSW	8	70779607	missense	probably benign	0.13
R3919:Mast3	UTSW	8	70779422	missense	probably benign	0.02
R4027:Mast3	UTSW	8	70787908	missense	probably damaging	1.00
R4060:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4061:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4062:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4063:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R4588:Mast3	UTSW	8	70780607	nonsense	probably null
R4672:Mast3	UTSW	8	70784797	frame shift	probably null
R4770:Mast3	UTSW	8	70786220	missense	probably damaging	1.00
R4822:Mast3	UTSW	8	70780366	missense	probably damaging	1.00
R4830:Mast3	UTSW	8	70788915	missense	possibly damaging	0.87
R5196:Mast3	UTSW	8	70788245	missense	probably damaging	1.00
R5333:Mast3	UTSW	8	70783501	missense	probably benign	0.03
R5428:Mast3	UTSW	8	70784733	missense	possibly damaging	0.95
R5656:Mast3	UTSW	8	70786221	missense	probably damaging	1.00
R5920:Mast3	UTSW	8	70787933	missense	probably benign	0.00
R6177:Mast3	UTSW	8	70790018	missense	probably damaging	1.00
R6186:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
R6407:Mast3	UTSW	8	70782128	missense	probably benign	0.02
R6614:Mast3	UTSW	8	70781966	missense	possibly damaging	0.95
R6804:Mast3	UTSW	8	70786732	missense	probably benign	0.29
R6873:Mast3	UTSW	8	70786592	nonsense	probably null
R6930:Mast3	UTSW	8	70799471	nonsense	probably null
R6948:Mast3	UTSW	8	70785482	missense	probably damaging	1.00
R7084:Mast3	UTSW	8	70779473	missense	probably benign	0.14
R7253:Mast3	UTSW	8	70789682	critical splice donor site	probably null
R7316:Mast3	UTSW	8	70779788	missense	probably damaging	1.00
R7357:Mast3	UTSW	8	70784859	missense	probably damaging	1.00
R7405:Mast3	UTSW	8	70786171	missense	probably damaging	1.00
R7429:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7430:Mast3	UTSW	8	70780303	missense	probably damaging	1.00
R7521:Mast3	UTSW	8	70788768	missense	probably benign	0.16
R7576:Mast3	UTSW	8	70781194	missense	probably damaging	1.00
R7933:Mast3	UTSW	8	70786635	missense	probably damaging	1.00
R7998:Mast3	UTSW	8	70783570	missense	probably benign
R8021:Mast3	UTSW	8	70788252	missense	probably benign	0.02
R8204:Mast3	UTSW	8	70788281	missense	probably benign	0.00
R8327:Mast3	UTSW	8	70779418	missense	probably damaging	1.00
R8357:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8415:Mast3	UTSW	8	70781222	missense	probably damaging	1.00
R8457:Mast3	UTSW	8	70780441	missense	probably benign	0.39
R8530:Mast3	UTSW	8	70788233	missense	possibly damaging	0.92
R8891:Mast3	UTSW	8	70781157	missense	probably damaging	1.00
R8930:Mast3	UTSW	8	70781733	splice site	probably benign
R9002:Mast3	UTSW	8	70781260	missense	probably damaging	1.00
R9085:Mast3	UTSW	8	70796717	missense	unknown
R9087:Mast3	UTSW	8	70789686	missense	possibly damaging	0.93
R9148:Mast3	UTSW	8	70780447	missense	probably damaging	0.98
R9364:Mast3	UTSW	8	70786182	missense	probably damaging	1.00
R9779:Mast3	UTSW	8	70785483	missense	probably damaging	1.00
Z1177:Mast3	UTSW	8	70789038	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCTTCAAGCTGTGGGACAAACTCTG -3'
(R):5'- AAGGGTCTGAGGTGACCACAATGC -3'

Sequencing Primer
(F):5'- TTTCCCACTGAATGGAGCCAG -3'
(R):5'- GGTGACCACAATGCTACCTC -3'

Posted On

2014-05-23