Incidental Mutation 'R1738:Ak9'
ID199881
Institutional Source Beutler Lab
Gene Symbol Ak9
Ensembl Gene ENSMUSG00000091415
Gene Nameadenylate kinase 9
SynonymsLOC215946, Akd1, Gm7127, Akd2
MMRRC Submission 039770-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.239) question?
Stock #R1738 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location41303980-41434534 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 41335921 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 218 (Q218L)
Ref Sequence ENSEMBL: ENSMUSP00000134177 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000173494]
Predicted Effect possibly damaging
Transcript: ENSMUST00000173494
AA Change: Q218L

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134177
Gene: ENSMUSG00000091415
AA Change: Q218L

DomainStartEndE-ValueType
AAA 30 330 4.65e-3 SMART
AAA 391 733 9.11e-1 SMART
Pfam:DUF3508 812 971 1.4e-7 PFAM
AAA 974 1297 1.2e-1 SMART
Blast:AAA 1326 1388 8e-18 BLAST
AAA 1393 1824 1.44e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000173517
AA Change: Q218L

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134344
Gene: ENSMUSG00000091415
AA Change: Q218L

DomainStartEndE-ValueType
AAA 30 330 4.65e-3 SMART
low complexity region 378 392 N/A INTRINSIC
internal_repeat_1 397 436 8.49e-5 PROSPERO
low complexity region 488 499 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.7%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the interconversion of nucleosides, possessing both nucleoside monophosphate and diphosphate kinase activities. The encoded protein uses these interconversions to maintain nucleoside homeostasis. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,611 Y202C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl3 T G 5: 81,387,979 M155R probably damaging Het
Akap13 G A 7: 75,677,194 G647D probably damaging Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Arhgap19 A G 19: 41,784,381 I291T probably benign Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
BC067074 T G 13: 113,367,500 L179R possibly damaging Het
Bsn T C 9: 108,106,934 D3307G unknown Het
Ces2h T A 8: 105,019,065 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a3 T C 1: 90,816,361 E88G probably damaging Het
Coro6 A G 11: 77,469,425 D407G probably benign Het
Cpe A T 8: 64,611,441 F241L probably damaging Het
Csde1 A G 3: 103,029,177 probably benign Het
Dgki A G 6: 37,057,432 I361T possibly damaging Het
Dnah3 A G 7: 120,035,359 V1298A probably damaging Het
Duox2 T A 2: 122,293,414 I430F probably damaging Het
Gak T C 5: 108,616,976 Y153C probably damaging Het
Gal3st2 T A 1: 93,874,596 probably null Het
Gbp11 T C 5: 105,326,644 N389D probably benign Het
Grm1 A G 10: 10,936,419 V287A probably damaging Het
Hsp90ab1 T C 17: 45,571,806 K36E probably damaging Het
Il24 T A 1: 130,887,362 probably null Het
Ino80d T C 1: 63,093,465 D13G probably damaging Het
Ipp G A 4: 116,530,421 V399I probably benign Het
Kank3 A T 17: 33,817,194 D12V probably damaging Het
Lcn12 A T 2: 25,493,251 S74R probably damaging Het
Mast3 T C 8: 70,784,556 T637A probably benign Het
Nes C A 3: 87,976,421 Y662* probably null Het
Nudt13 A T 14: 20,309,694 H163L probably damaging Het
Olfr1046 A T 2: 86,217,716 probably null Het
Olfr1178 G A 2: 88,391,327 V27I probably benign Het
Olfr1239 T C 2: 89,418,018 T132A probably benign Het
Olfr346 T C 2: 36,688,785 V261A probably benign Het
Pde6b C T 5: 108,430,559 R788* probably null Het
Pex13 A G 11: 23,649,458 L351P probably benign Het
Phc1 A G 6: 122,318,566 M942T probably damaging Het
Plch1 A T 3: 63,719,238 D571E probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhh2 A G 17: 84,566,697 N470S possibly damaging Het
Primpol A G 8: 46,607,838 S82P probably damaging Het
Prkg1 T C 19: 30,786,922 D256G possibly damaging Het
Prune2 A G 19: 17,125,010 E2511G probably benign Het
Rassf8 T C 6: 145,815,308 I120T probably benign Het
Rfx4 G A 10: 84,880,975 probably null Het
Rtp2 A T 16: 23,927,673 N69K probably benign Het
Sh3d19 A T 3: 86,120,606 I597F probably damaging Het
Sorl1 T A 9: 42,089,965 E246D probably benign Het
Spert C T 14: 75,593,057 M1I probably null Het
Tet2 T A 3: 133,481,387 I1094L probably benign Het
Tlr4 A T 4: 66,841,076 H702L probably benign Het
Tnfrsf14 T C 4: 154,925,331 D47G probably damaging Het
Ttn T C 2: 76,946,813 Y1415C probably damaging Het
Vmn2r17 T A 5: 109,428,511 F416Y probably benign Het
Vmn2r54 A G 7: 12,635,888 S83P probably benign Het
Vtn A G 11: 78,499,596 D53G possibly damaging Het
Vwde A T 6: 13,190,724 V456D probably damaging Het
Wdr91 G A 6: 34,884,308 P653L probably damaging Het
Ythdf1 G A 2: 180,911,492 A283V probably benign Het
Zfp975 C A 7: 42,662,949 W80L probably benign Het
Other mutations in Ak9
AlleleSourceChrCoordTypePredicted EffectPPH Score
Mean UTSW 10 41357563 missense possibly damaging 0.59
R0057:Ak9 UTSW 10 41392728 missense probably benign 0.04
R0605:Ak9 UTSW 10 41345139 missense probably damaging 1.00
R0658:Ak9 UTSW 10 41347222 missense probably damaging 0.98
R1696:Ak9 UTSW 10 41327589 missense possibly damaging 0.73
R1815:Ak9 UTSW 10 41337576 missense probably damaging 1.00
R2900:Ak9 UTSW 10 41424755 missense unknown
R3123:Ak9 UTSW 10 41358580 missense possibly damaging 0.46
R3715:Ak9 UTSW 10 41357512 missense probably damaging 0.96
R4092:Ak9 UTSW 10 41389144 missense probably benign 0.29
R4193:Ak9 UTSW 10 41335945 missense probably benign 0.14
R4598:Ak9 UTSW 10 41383911 missense probably damaging 1.00
R4621:Ak9 UTSW 10 41406891 missense possibly damaging 0.55
R4681:Ak9 UTSW 10 41427238 missense unknown
R4707:Ak9 UTSW 10 41345460 missense probably benign 0.36
R4908:Ak9 UTSW 10 41420682 missense unknown
R4952:Ak9 UTSW 10 41420589 missense probably benign 0.07
R5162:Ak9 UTSW 10 41357657 missense probably damaging 1.00
R5446:Ak9 UTSW 10 41420509 missense possibly damaging 0.70
R5494:Ak9 UTSW 10 41347169 missense probably damaging 1.00
R5517:Ak9 UTSW 10 41340891 missense probably benign 0.23
R5849:Ak9 UTSW 10 41348049 missense probably benign 0.31
R5858:Ak9 UTSW 10 41423027 missense unknown
R5920:Ak9 UTSW 10 41420676 missense probably benign 0.30
R5952:Ak9 UTSW 10 41357563 missense possibly damaging 0.59
R5955:Ak9 UTSW 10 41358564 missense probably damaging 1.00
R6050:Ak9 UTSW 10 41389112 missense possibly damaging 0.74
R6087:Ak9 UTSW 10 41382832 missense probably benign 0.01
R6190:Ak9 UTSW 10 41422407 missense unknown
R6190:Ak9 UTSW 10 41422408 missense unknown
R6197:Ak9 UTSW 10 41317830 missense probably damaging 0.98
R6220:Ak9 UTSW 10 41370099 missense unknown
R6250:Ak9 UTSW 10 41389034 missense possibly damaging 0.54
R6315:Ak9 UTSW 10 41406841 missense possibly damaging 0.55
R6331:Ak9 UTSW 10 41382829 missense probably damaging 0.99
R6812:Ak9 UTSW 10 41367167 missense unknown
R6847:Ak9 UTSW 10 41357801 intron probably null
R7128:Ak9 UTSW 10 41424717 missense unknown
R7253:Ak9 UTSW 10 41432484 missense unknown
R7286:Ak9 UTSW 10 41407371 missense
R7401:Ak9 UTSW 10 41423004 missense unknown
R7478:Ak9 UTSW 10 41389091 missense
R7698:Ak9 UTSW 10 41348076 missense
Predicted Primers PCR Primer
(F):5'- TGCGCTTATTGAGAACAACAGCAAC -3'
(R):5'- CTTATCTTGAGCAGCATGGAGGGG -3'

Sequencing Primer
(F):5'- AAACTAACAAGTTCTCACGCAGG -3'
(R):5'- cacacacacacacacacac -3'
Posted On2014-05-23