Incidental Mutation 'R1738:Rfx4'
ID199882
Institutional Source Beutler Lab
Gene Symbol Rfx4
Ensembl Gene ENSMUSG00000020037
Gene Nameregulatory factor X, 4 (influences HLA class II expression)
Synonyms4933412G19Rik
MMRRC Submission 039770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1738 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location84756062-84906538 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 84880975 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128690 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060397] [ENSMUST00000095388] [ENSMUST00000166696]
Predicted Effect probably null
Transcript: ENSMUST00000060397
SMART Domains Protein: ENSMUSP00000051107
Gene: ENSMUSG00000020037

DomainStartEndE-ValueType
Pfam:RFX_DNA_binding 58 136 7.9e-37 PFAM
Blast:HisKA 293 356 5e-7 BLAST
low complexity region 503 515 N/A INTRINSIC
low complexity region 521 537 N/A INTRINSIC
low complexity region 599 611 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000095388
SMART Domains Protein: ENSMUSP00000093035
Gene: ENSMUSG00000020037

DomainStartEndE-ValueType
SCOP:d1kwha_ 11 201 6e-3 SMART
Blast:HisKA 199 262 4e-7 BLAST
low complexity region 409 421 N/A INTRINSIC
low complexity region 427 443 N/A INTRINSIC
low complexity region 505 517 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166696
SMART Domains Protein: ENSMUSP00000128690
Gene: ENSMUSG00000020037

DomainStartEndE-ValueType
Blast:HisKA 150 213 6e-7 BLAST
low complexity region 360 372 N/A INTRINSIC
low complexity region 378 394 N/A INTRINSIC
low complexity region 456 468 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.7%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the regulatory factor X gene family, which encodes transcription factors that contain a highly-conserved winged helix DNA binding domain. The protein encoded by this gene is structurally related to regulatory factors X1, X2, X3, and X5. It has been shown to interact with itself as well as with regulatory factors X2 and X3, but it does not interact with regulatory factor X1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2011]
PHENOTYPE: Inactivating null allele or homozygous point mutation alleles exhibit missing dorsal midline structure of the cortex including the subcommissural organ and neonatal lethality. Heterozygous null mice have congenital hydrocephalus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,611 Y202C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl3 T G 5: 81,387,979 M155R probably damaging Het
Ak9 A T 10: 41,335,921 Q218L possibly damaging Het
Akap13 G A 7: 75,677,194 G647D probably damaging Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Arhgap19 A G 19: 41,784,381 I291T probably benign Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
BC067074 T G 13: 113,367,500 L179R possibly damaging Het
Bsn T C 9: 108,106,934 D3307G unknown Het
Ces2h T A 8: 105,019,065 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a3 T C 1: 90,816,361 E88G probably damaging Het
Coro6 A G 11: 77,469,425 D407G probably benign Het
Cpe A T 8: 64,611,441 F241L probably damaging Het
Csde1 A G 3: 103,029,177 probably benign Het
Dgki A G 6: 37,057,432 I361T possibly damaging Het
Dnah3 A G 7: 120,035,359 V1298A probably damaging Het
Duox2 T A 2: 122,293,414 I430F probably damaging Het
Gak T C 5: 108,616,976 Y153C probably damaging Het
Gal3st2 T A 1: 93,874,596 probably null Het
Gbp11 T C 5: 105,326,644 N389D probably benign Het
Grm1 A G 10: 10,936,419 V287A probably damaging Het
Hsp90ab1 T C 17: 45,571,806 K36E probably damaging Het
Il24 T A 1: 130,887,362 probably null Het
Ino80d T C 1: 63,093,465 D13G probably damaging Het
Ipp G A 4: 116,530,421 V399I probably benign Het
Kank3 A T 17: 33,817,194 D12V probably damaging Het
Lcn12 A T 2: 25,493,251 S74R probably damaging Het
Mast3 T C 8: 70,784,556 T637A probably benign Het
Nes C A 3: 87,976,421 Y662* probably null Het
Nudt13 A T 14: 20,309,694 H163L probably damaging Het
Olfr1046 A T 2: 86,217,716 probably null Het
Olfr1178 G A 2: 88,391,327 V27I probably benign Het
Olfr1239 T C 2: 89,418,018 T132A probably benign Het
Olfr346 T C 2: 36,688,785 V261A probably benign Het
Pde6b C T 5: 108,430,559 R788* probably null Het
Pex13 A G 11: 23,649,458 L351P probably benign Het
Phc1 A G 6: 122,318,566 M942T probably damaging Het
Plch1 A T 3: 63,719,238 D571E probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhh2 A G 17: 84,566,697 N470S possibly damaging Het
Primpol A G 8: 46,607,838 S82P probably damaging Het
Prkg1 T C 19: 30,786,922 D256G possibly damaging Het
Prune2 A G 19: 17,125,010 E2511G probably benign Het
Rassf8 T C 6: 145,815,308 I120T probably benign Het
Rtp2 A T 16: 23,927,673 N69K probably benign Het
Sh3d19 A T 3: 86,120,606 I597F probably damaging Het
Sorl1 T A 9: 42,089,965 E246D probably benign Het
Spert C T 14: 75,593,057 M1I probably null Het
Tet2 T A 3: 133,481,387 I1094L probably benign Het
Tlr4 A T 4: 66,841,076 H702L probably benign Het
Tnfrsf14 T C 4: 154,925,331 D47G probably damaging Het
Ttn T C 2: 76,946,813 Y1415C probably damaging Het
Vmn2r17 T A 5: 109,428,511 F416Y probably benign Het
Vmn2r54 A G 7: 12,635,888 S83P probably benign Het
Vtn A G 11: 78,499,596 D53G possibly damaging Het
Vwde A T 6: 13,190,724 V456D probably damaging Het
Wdr91 G A 6: 34,884,308 P653L probably damaging Het
Ythdf1 G A 2: 180,911,492 A283V probably benign Het
Zfp975 C A 7: 42,662,949 W80L probably benign Het
Other mutations in Rfx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Rfx4 APN 10 84840199 missense probably damaging 1.00
IGL00334:Rfx4 APN 10 84780053 missense possibly damaging 0.91
IGL00928:Rfx4 APN 10 84840114 missense probably benign 0.04
IGL01063:Rfx4 APN 10 84868382 missense possibly damaging 0.90
IGL01490:Rfx4 APN 10 84840851 missense possibly damaging 0.85
IGL02390:Rfx4 APN 10 84840150 missense probably damaging 1.00
IGL02454:Rfx4 APN 10 84840106 missense possibly damaging 0.83
R0099:Rfx4 UTSW 10 84894304 missense probably benign
R0503:Rfx4 UTSW 10 84894332 missense possibly damaging 0.56
R0924:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R0930:Rfx4 UTSW 10 84868427 missense probably damaging 1.00
R1386:Rfx4 UTSW 10 84863285 missense probably damaging 1.00
R1715:Rfx4 UTSW 10 84844280 missense probably damaging 1.00
R1987:Rfx4 UTSW 10 84896088 missense possibly damaging 0.87
R3717:Rfx4 UTSW 10 84880224 missense probably damaging 1.00
R4231:Rfx4 UTSW 10 84814694 missense probably benign 0.03
R4300:Rfx4 UTSW 10 84905102 missense probably damaging 0.98
R4581:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4582:Rfx4 UTSW 10 84844300 missense possibly damaging 0.93
R4618:Rfx4 UTSW 10 84880896 missense probably benign 0.01
R5156:Rfx4 UTSW 10 84868354 missense probably damaging 1.00
R5185:Rfx4 UTSW 10 84863250 missense probably damaging 1.00
R5377:Rfx4 UTSW 10 84860542 missense possibly damaging 0.81
R5601:Rfx4 UTSW 10 84798578 missense probably damaging 1.00
R5879:Rfx4 UTSW 10 84814761 critical splice donor site probably null
R5996:Rfx4 UTSW 10 84840017 nonsense probably null
R6358:Rfx4 UTSW 10 84844235 missense probably damaging 1.00
R6805:Rfx4 UTSW 10 84840228 missense possibly damaging 0.86
R7248:Rfx4 UTSW 10 84905055 missense probably benign 0.05
R7427:Rfx4 UTSW 10 84896012 missense probably benign 0.28
R7428:Rfx4 UTSW 10 84896012 missense probably benign 0.28
R7514:Rfx4 UTSW 10 84880226 missense probably damaging 1.00
R7576:Rfx4 UTSW 10 84863349 missense probably damaging 0.98
R8002:Rfx4 UTSW 10 84840857 missense probably damaging 0.97
RF005:Rfx4 UTSW 10 84858494 critical splice acceptor site probably benign
RF010:Rfx4 UTSW 10 84858487 critical splice acceptor site probably benign
RF014:Rfx4 UTSW 10 84858489 critical splice acceptor site probably benign
RF015:Rfx4 UTSW 10 84858489 critical splice acceptor site probably benign
RF023:Rfx4 UTSW 10 84858485 critical splice acceptor site probably benign
RF030:Rfx4 UTSW 10 84858480 critical splice acceptor site probably benign
RF035:Rfx4 UTSW 10 84858480 critical splice acceptor site probably benign
RF046:Rfx4 UTSW 10 84858481 critical splice acceptor site probably benign
RF060:Rfx4 UTSW 10 84858494 critical splice acceptor site probably benign
RF062:Rfx4 UTSW 10 84858481 critical splice acceptor site probably benign
X0024:Rfx4 UTSW 10 84780074 missense possibly damaging 0.82
Z1177:Rfx4 UTSW 10 84814684 missense possibly damaging 0.85
Z1177:Rfx4 UTSW 10 84896091 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCTCTGTTTGCAGCAGAAGCCC -3'
(R):5'- TGTCTCTTGTTTCCAAGGATGCCTG -3'

Sequencing Primer
(F):5'- GCCCAGGAAGAGATTATCTTGAC -3'
(R):5'- GGATGCCTGTATACTAGCTTACACG -3'
Posted On2014-05-23