Incidental Mutation 'R1738:Hsp90ab1'
ID199899
Institutional Source Beutler Lab
Gene Symbol Hsp90ab1
Ensembl Gene ENSMUSG00000023944
Gene Nameheat shock protein 90 alpha (cytosolic), class B member 1
SynonymsHspcb, Hsp84, Hsp90, C81438, Hsp84-1
MMRRC Submission 039770-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1738 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location45567775-45573271 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45571806 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 36 (K36E)
Ref Sequence ENSEMBL: ENSMUSP00000024739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024739] [ENSMUST00000041353] [ENSMUST00000130406] [ENSMUST00000163966] [ENSMUST00000165127] [ENSMUST00000166469] [ENSMUST00000223987] [ENSMUST00000224905]
Predicted Effect probably damaging
Transcript: ENSMUST00000024739
AA Change: K36E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000024739
Gene: ENSMUSG00000023944
AA Change: K36E

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
HATPase_c 35 189 3.82e-10 SMART
Pfam:HSP90 191 719 5.4e-246 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000041353
SMART Domains Protein: ENSMUSP00000037834
Gene: ENSMUSG00000037089

DomainStartEndE-ValueType
Pfam:UAA 62 363 5.1e-79 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130406
AA Change: K36E

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000119678
Gene: ENSMUSG00000023944
AA Change: K36E

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 76 2e-32 SMART
PDB:1UYM|A 14 76 7e-38 PDB
Blast:HATPase_c 35 76 3e-21 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146770
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151306
Predicted Effect possibly damaging
Transcript: ENSMUST00000163966
AA Change: K36E

PolyPhen 2 Score 0.848 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000131601
Gene: ENSMUSG00000023944
AA Change: K36E

DomainStartEndE-ValueType
SCOP:d1byqa_ 9 85 9e-40 SMART
PDB:1UYM|A 14 85 3e-45 PDB
Blast:HATPase_c 35 85 9e-29 BLAST
low complexity region 93 107 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000165127
AA Change: K36E
SMART Domains Protein: ENSMUSP00000126239
Gene: ENSMUSG00000023944
AA Change: K36E

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
Pfam:HSP90 37 161 3.8e-60 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166469
SMART Domains Protein: ENSMUSP00000127338
Gene: ENSMUSG00000023944

DomainStartEndE-ValueType
Pfam:HSP90 4 189 1.3e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000223987
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224559
Predicted Effect probably benign
Transcript: ENSMUST00000224905
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.7%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the heat shock protein 90 family; these proteins are involved in signal transduction, protein folding and degradation and morphological evolution. This gene encodes the constitutive form of the cytosolic 90 kDa heat-shock protein and is thought to play a role in gastric apoptosis and inflammation. Alternative splicing results in multiple transcript variants. Pseudogenes have been identified on multiple chromosomes. [provided by RefSeq, Dec 2012]
PHENOTYPE: Homozygotes for a gene-trapped null mutation exhibit placental defects including failure to form a placental labyrinth and lack of expansion of allantoic blood vessels. Mutants die around mid-gestation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930562C15Rik A G 16: 4,864,611 Y202C probably damaging Het
Adamts16 G A 13: 70,779,518 probably benign Het
Adgrl3 T G 5: 81,387,979 M155R probably damaging Het
Ak9 A T 10: 41,335,921 Q218L possibly damaging Het
Akap13 G A 7: 75,677,194 G647D probably damaging Het
Angptl3 A G 4: 99,033,262 T206A probably benign Het
Arhgap19 A G 19: 41,784,381 I291T probably benign Het
BC049715 C T 6: 136,840,308 P182L probably damaging Het
BC067074 T G 13: 113,367,500 L179R possibly damaging Het
Bsn T C 9: 108,106,934 D3307G unknown Het
Ces2h T A 8: 105,019,065 probably null Het
Ces4a G A 8: 105,138,097 G69S probably damaging Het
Col4a2 T A 8: 11,446,238 F1620I probably damaging Het
Col6a3 T C 1: 90,816,361 E88G probably damaging Het
Coro6 A G 11: 77,469,425 D407G probably benign Het
Cpe A T 8: 64,611,441 F241L probably damaging Het
Csde1 A G 3: 103,029,177 probably benign Het
Dgki A G 6: 37,057,432 I361T possibly damaging Het
Dnah3 A G 7: 120,035,359 V1298A probably damaging Het
Duox2 T A 2: 122,293,414 I430F probably damaging Het
Gak T C 5: 108,616,976 Y153C probably damaging Het
Gal3st2 T A 1: 93,874,596 probably null Het
Gbp11 T C 5: 105,326,644 N389D probably benign Het
Grm1 A G 10: 10,936,419 V287A probably damaging Het
Il24 T A 1: 130,887,362 probably null Het
Ino80d T C 1: 63,093,465 D13G probably damaging Het
Ipp G A 4: 116,530,421 V399I probably benign Het
Kank3 A T 17: 33,817,194 D12V probably damaging Het
Lcn12 A T 2: 25,493,251 S74R probably damaging Het
Mast3 T C 8: 70,784,556 T637A probably benign Het
Nes C A 3: 87,976,421 Y662* probably null Het
Nudt13 A T 14: 20,309,694 H163L probably damaging Het
Olfr1046 A T 2: 86,217,716 probably null Het
Olfr1178 G A 2: 88,391,327 V27I probably benign Het
Olfr1239 T C 2: 89,418,018 T132A probably benign Het
Olfr346 T C 2: 36,688,785 V261A probably benign Het
Pde6b C T 5: 108,430,559 R788* probably null Het
Pex13 A G 11: 23,649,458 L351P probably benign Het
Phc1 A G 6: 122,318,566 M942T probably damaging Het
Plch1 A T 3: 63,719,238 D571E probably benign Het
Plec C T 15: 76,186,218 V931M probably damaging Het
Plekhh2 A G 17: 84,566,697 N470S possibly damaging Het
Primpol A G 8: 46,607,838 S82P probably damaging Het
Prkg1 T C 19: 30,786,922 D256G possibly damaging Het
Prune2 A G 19: 17,125,010 E2511G probably benign Het
Rassf8 T C 6: 145,815,308 I120T probably benign Het
Rfx4 G A 10: 84,880,975 probably null Het
Rtp2 A T 16: 23,927,673 N69K probably benign Het
Sh3d19 A T 3: 86,120,606 I597F probably damaging Het
Sorl1 T A 9: 42,089,965 E246D probably benign Het
Spert C T 14: 75,593,057 M1I probably null Het
Tet2 T A 3: 133,481,387 I1094L probably benign Het
Tlr4 A T 4: 66,841,076 H702L probably benign Het
Tnfrsf14 T C 4: 154,925,331 D47G probably damaging Het
Ttn T C 2: 76,946,813 Y1415C probably damaging Het
Vmn2r17 T A 5: 109,428,511 F416Y probably benign Het
Vmn2r54 A G 7: 12,635,888 S83P probably benign Het
Vtn A G 11: 78,499,596 D53G possibly damaging Het
Vwde A T 6: 13,190,724 V456D probably damaging Het
Wdr91 G A 6: 34,884,308 P653L probably damaging Het
Ythdf1 G A 2: 180,911,492 A283V probably benign Het
Zfp975 C A 7: 42,662,949 W80L probably benign Het
Other mutations in Hsp90ab1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Hsp90ab1 APN 17 45569564 missense probably damaging 0.96
IGL02234:Hsp90ab1 APN 17 45569735 missense probably benign 0.01
IGL02275:Hsp90ab1 APN 17 45568438 missense possibly damaging 0.76
IGL03069:Hsp90ab1 APN 17 45569028 missense possibly damaging 0.65
IGL03104:Hsp90ab1 APN 17 45571523 missense probably damaging 0.99
R0457:Hsp90ab1 UTSW 17 45568988 missense probably damaging 1.00
R0787:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R0788:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R0790:Hsp90ab1 UTSW 17 45569499 unclassified probably benign
R1142:Hsp90ab1 UTSW 17 45568974 nonsense probably null
R2109:Hsp90ab1 UTSW 17 45569328 missense probably benign 0.32
R2156:Hsp90ab1 UTSW 17 45569703 missense possibly damaging 0.82
R2509:Hsp90ab1 UTSW 17 45569341 missense probably damaging 1.00
R3686:Hsp90ab1 UTSW 17 45569288 missense probably damaging 1.00
R3695:Hsp90ab1 UTSW 17 45571477 missense probably damaging 0.98
R3700:Hsp90ab1 UTSW 17 45571514 missense possibly damaging 0.69
R4968:Hsp90ab1 UTSW 17 45571036 missense probably benign 0.05
R5809:Hsp90ab1 UTSW 17 45570649 unclassified probably benign
R6833:Hsp90ab1 UTSW 17 45570467 missense probably benign
R6834:Hsp90ab1 UTSW 17 45570467 missense probably benign
R7392:Hsp90ab1 UTSW 17 45569048 missense probably benign 0.10
R7400:Hsp90ab1 UTSW 17 45569284 missense probably benign 0.04
R7584:Hsp90ab1 UTSW 17 45570271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGTCCAACTTAGAAGGGTCCGTC -3'
(R):5'- AGTGAGCTATGCACTGAACATGCC -3'

Sequencing Primer
(F):5'- CTTGTCCAGGGCCTGTAGTAAAC -3'
(R):5'- AGAAAATGGCTGCTCTTGTCTC -3'
Posted On2014-05-23