Incidental Mutation 'R0088:Pklr'
ID19993
Institutional Source Beutler Lab
Gene Symbol Pklr
Ensembl Gene ENSMUSG00000041237
Gene Namepyruvate kinase liver and red blood cell
SynonymsPk1, R-PK, Pk-1
MMRRC Submission 038375-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R0088 (G1)
Quality Score225
Status Validated (trace)
Chromosome3
Chromosomal Location89136142-89146784 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89141908 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 187 (Y187C)
Ref Sequence ENSEMBL: ENSMUSP00000103106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029686] [ENSMUST00000047111] [ENSMUST00000107482] [ENSMUST00000127058]
Predicted Effect probably benign
Transcript: ENSMUST00000029686
SMART Domains Protein: ENSMUSP00000029686
Gene: ENSMUSG00000028051

DomainStartEndE-ValueType
low complexity region 2 32 N/A INTRINSIC
Pfam:Ion_trans_N 48 91 1.3e-22 PFAM
Pfam:Ion_trans 92 357 3.7e-25 PFAM
low complexity region 358 369 N/A INTRINSIC
Blast:cNMP 370 402 7e-14 BLAST
cNMP 427 540 2.32e-20 SMART
Blast:cNMP 548 588 2e-17 BLAST
low complexity region 636 656 N/A INTRINSIC
low complexity region 698 717 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047111
AA Change: Y218C

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000035417
Gene: ENSMUSG00000041237
AA Change: Y218C

DomainStartEndE-ValueType
low complexity region 23 37 N/A INTRINSIC
Pfam:PK 85 438 6.9e-165 PFAM
Pfam:PK_C 453 571 3.6e-33 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107482
AA Change: Y187C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000103106
Gene: ENSMUSG00000041237
AA Change: Y187C

DomainStartEndE-ValueType
Pfam:PK 54 407 3.1e-163 PFAM
Pfam:PK_C 421 541 4.9e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127058
SMART Domains Protein: ENSMUSP00000119392
Gene: ENSMUSG00000041237

DomainStartEndE-ValueType
Pfam:PK 21 72 7.6e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148097
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151591
Meta Mutation Damage Score 0.7387 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 82% (32/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a pyruvate kinase that catalyzes the transphosphorylation of phohsphoenolpyruvate into pyruvate and ATP, which is the rate-limiting step of glycolysis. Defects in this enzyme, due to gene mutations or genetic variations, are the common cause of chronic hereditary nonspherocytic hemolytic anemia (CNSHA or HNSHA). Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for loss of function mutations in this gene suffer from hemolytic anemia. This is also a candidate gene for malaria resistance QTL Char4 and immunity to Salmonella typhimurium QTL Ity4. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,914,067 K243R probably damaging Het
Akap9 C A 5: 3,961,946 T883K probably benign Het
Arhgap5 G T 12: 52,516,548 D101Y probably damaging Het
Bnc1 T G 7: 81,978,498 N39T possibly damaging Het
Carnmt1 T A 19: 18,677,853 H123Q probably benign Het
Cdh24 T C 14: 54,633,714 D92G probably damaging Het
Eomes A G 9: 118,478,673 E5G probably damaging Het
Eqtn T C 4: 94,919,990 T192A probably damaging Het
Fam110c T C 12: 31,075,218 V393A probably damaging Het
Fbll1 C A 11: 35,798,140 A99S possibly damaging Het
Il1rl2 A T 1: 40,365,053 I445F possibly damaging Het
Ipo8 T C 6: 148,801,936 T400A probably benign Het
Iqsec3 T C 6: 121,473,289 E92G probably damaging Het
Itpr2 C T 6: 146,241,185 V1679M probably benign Het
Kif2a G A 13: 106,975,432 A478V probably damaging Het
Lingo4 A G 3: 94,402,033 S93G probably benign Het
Mrpl37 A G 4: 107,064,424 S203P possibly damaging Het
Ndel1 A C 11: 68,833,420 S242R probably damaging Het
Nfatc3 T A 8: 106,127,942 M1036K possibly damaging Het
Ngrn T C 7: 80,264,455 I118T probably damaging Het
Olfr975 A G 9: 39,950,375 V132A probably benign Het
Pex10 A T 4: 155,070,498 S236C probably damaging Het
Phkb T G 8: 85,942,391 probably null Het
Plekhh1 A C 12: 79,055,366 E403D probably benign Het
Pls1 T C 9: 95,795,768 K22E possibly damaging Het
Prdm2 G A 4: 143,134,954 H589Y possibly damaging Het
Rabggtb C A 3: 153,908,830 R230L probably damaging Het
Rsph4a A G 10: 33,909,353 E420G probably benign Het
Sdk2 T C 11: 113,827,086 N1484S possibly damaging Het
St8sia3 T A 18: 64,266,985 V17E possibly damaging Het
Sult6b2 T A 6: 142,797,949 N117I probably damaging Het
Thbs2 T C 17: 14,681,701 T422A possibly damaging Het
Tmem266 A G 9: 55,437,329 D415G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttyh2 G T 11: 114,690,255 G107C probably damaging Het
Ubr4 A G 4: 139,440,814 D2835G probably damaging Het
Zranb3 T C 1: 127,976,462 D540G probably benign Het
Other mutations in Pklr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01656:Pklr APN 3 89144995 missense probably damaging 1.00
IGL02108:Pklr APN 3 89137403 missense probably damaging 1.00
IGL03030:Pklr APN 3 89142656 missense probably damaging 1.00
IGL03401:Pklr APN 3 89142729 missense probably benign 0.41
R0801:Pklr UTSW 3 89145522 nonsense probably null
R1061:Pklr UTSW 3 89144881 missense probably damaging 1.00
R1434:Pklr UTSW 3 89143035 missense probably damaging 1.00
R2030:Pklr UTSW 3 89143238 missense probably damaging 1.00
R2131:Pklr UTSW 3 89142660 missense probably damaging 1.00
R3703:Pklr UTSW 3 89142701 missense probably damaging 1.00
R4372:Pklr UTSW 3 89145523 nonsense probably null
R5279:Pklr UTSW 3 89143259 missense probably damaging 1.00
R5401:Pklr UTSW 3 89141866 missense probably damaging 1.00
R5809:Pklr UTSW 3 89141784 missense probably benign
R5946:Pklr UTSW 3 89136196 missense probably benign 0.43
R6331:Pklr UTSW 3 89137355 missense probably damaging 0.99
R7559:Pklr UTSW 3 89143058 missense probably damaging 1.00
R7711:Pklr UTSW 3 89141342 missense probably damaging 1.00
R7848:Pklr UTSW 3 89142978 missense possibly damaging 0.81
R7931:Pklr UTSW 3 89142978 missense possibly damaging 0.81
Z1176:Pklr UTSW 3 89144855 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGTACCATGCAGAGTCCATCGCC -3'
(R):5'- TGCCAAGACTGAGCCGGGATATAG -3'

Sequencing Primer
(F):5'- TGAGAAGCAAGCCTCTGTCTG -3'
(R):5'- AAGCTTGGATTCTCAAATGCCC -3'
Posted On2013-04-11