Incidental Mutation 'R0088:Rabggtb'
ID19995
Institutional Source Beutler Lab
Gene Symbol Rabggtb
Ensembl Gene ENSMUSG00000038975
Gene NameRab geranylgeranyl transferase, b subunit
Synonyms
MMRRC Submission 038375-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.940) question?
Stock #R0088 (G1)
Quality Score200
Status Validated (trace)
Chromosome3
Chromosomal Location153907287-153913009 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 153908830 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 230 (R230L)
Ref Sequence ENSEMBL: ENSMUSP00000129481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005630] [ENSMUST00000089950] [ENSMUST00000167111] [ENSMUST00000188338] [ENSMUST00000190449] [ENSMUST00000196266] [ENSMUST00000196565] [ENSMUST00000196956] [ENSMUST00000197438] [ENSMUST00000200209] [ENSMUST00000200631]
PDB Structure
Crystal structure of RabGGTase(DELTA LRR; DELTA IG) in Complex with BMS3 [X-RAY DIFFRACTION]
Crystal structure of RabGGTase(DELTA LRR; DELTA IG) in Complex with BMS3 and lipid substrate GGPP [X-RAY DIFFRACTION]
Crystal structure of RabGGTase(DELTA LRR; DELTA IG) in Complex with BMS-analogue 14 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000005630
SMART Domains Protein: ENSMUSP00000005630
Gene: ENSMUSG00000005493

DomainStartEndE-ValueType
low complexity region 91 107 N/A INTRINSIC
Pfam:MutS_II 177 321 2.3e-20 PFAM
MUTSd 352 679 3.77e-37 SMART
MUTSac 695 888 1.6e-81 SMART
Blast:MUTSac 912 956 1e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082797
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083804
Predicted Effect probably damaging
Transcript: ENSMUST00000089950
AA Change: R222L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087396
Gene: ENSMUSG00000038975
AA Change: R222L

DomainStartEndE-ValueType
Pfam:Prenyltrans 66 109 3e-11 PFAM
Pfam:Prenyltrans_2 72 183 1.1e-19 PFAM
Pfam:Prenyltrans 114 157 2.2e-14 PFAM
Pfam:Prenyltrans_1 116 214 1.7e-9 PFAM
Pfam:Prenyltrans 162 205 8.1e-18 PFAM
Pfam:Prenyltrans 210 253 3.1e-15 PFAM
Pfam:Prenyltrans 258 302 3.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167111
AA Change: R230L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129481
Gene: ENSMUSG00000038975
AA Change: R230L

DomainStartEndE-ValueType
Pfam:Prenyltrans 74 117 5.9e-12 PFAM
Pfam:Prenyltrans 122 165 8.4e-15 PFAM
Pfam:Prenyltrans 170 213 2.2e-18 PFAM
Pfam:Prenyltrans 218 261 1.2e-15 PFAM
Pfam:Prenyltrans 266 310 2.1e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188338
SMART Domains Protein: ENSMUSP00000140190
Gene: ENSMUSG00000005493

DomainStartEndE-ValueType
Pfam:MutS_II 89 233 5.3e-19 PFAM
MUTSd 264 591 9.4e-40 SMART
MUTSac 607 800 4.2e-84 SMART
Blast:MUTSac 808 866 4e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190449
SMART Domains Protein: ENSMUSP00000140265
Gene: ENSMUSG00000005493

DomainStartEndE-ValueType
Pfam:MutS_II 1 127 3.3e-15 PFAM
MUTSd 158 485 9.4e-40 SMART
MUTSac 501 694 4.2e-84 SMART
Blast:MUTSac 702 760 5e-17 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196266
SMART Domains Protein: ENSMUSP00000142682
Gene: ENSMUSG00000038975

DomainStartEndE-ValueType
Pfam:Prenyltrans_2 32 143 9e-10 PFAM
Pfam:Prenyltrans 74 117 8.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196565
SMART Domains Protein: ENSMUSP00000143258
Gene: ENSMUSG00000038975

DomainStartEndE-ValueType
low complexity region 10 23 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196956
SMART Domains Protein: ENSMUSP00000143458
Gene: ENSMUSG00000038975

DomainStartEndE-ValueType
Pfam:Prenyltrans 74 117 2e-9 PFAM
Pfam:Prenyltrans_2 80 191 3.8e-18 PFAM
Pfam:Prenyltrans 122 165 1.4e-12 PFAM
Pfam:Prenyltrans_1 124 202 4.8e-7 PFAM
Pfam:Prenyltrans 170 201 9.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197147
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197294
Predicted Effect probably benign
Transcript: ENSMUST00000197438
SMART Domains Protein: ENSMUSP00000143551
Gene: ENSMUSG00000038975

DomainStartEndE-ValueType
Pfam:Prenyltrans 74 112 1.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197829
Predicted Effect probably benign
Transcript: ENSMUST00000198094
Predicted Effect probably benign
Transcript: ENSMUST00000198350
Predicted Effect probably benign
Transcript: ENSMUST00000200209
SMART Domains Protein: ENSMUSP00000143452
Gene: ENSMUSG00000038975

DomainStartEndE-ValueType
Pfam:Prenyltrans_2 32 143 9e-10 PFAM
Pfam:Prenyltrans 74 117 8.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200631
SMART Domains Protein: ENSMUSP00000142999
Gene: ENSMUSG00000038975

DomainStartEndE-ValueType
Pfam:Prenyltrans 74 112 5.3e-8 PFAM
Meta Mutation Damage Score 0.9392 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 82% (32/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta-subunit of the enzyme Rab geranylgeranyl-transferase (RabGGTase), which belongs to the protein prenyltransferase family. RabGGTase catalyzes the post-translational addition of geranylgeranyl groups to C-terminal cysteine residues of Rab GTPases. Three small nucleolar RNA genes are present in the intronic regions of this gene. Alternately spliced transcript variants have been observed for this gene. A pseudogene associated with this gene is located on chromosome 3. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,914,067 K243R probably damaging Het
Akap9 C A 5: 3,961,946 T883K probably benign Het
Arhgap5 G T 12: 52,516,548 D101Y probably damaging Het
Bnc1 T G 7: 81,978,498 N39T possibly damaging Het
Carnmt1 T A 19: 18,677,853 H123Q probably benign Het
Cdh24 T C 14: 54,633,714 D92G probably damaging Het
Eomes A G 9: 118,478,673 E5G probably damaging Het
Eqtn T C 4: 94,919,990 T192A probably damaging Het
Fam110c T C 12: 31,075,218 V393A probably damaging Het
Fbll1 C A 11: 35,798,140 A99S possibly damaging Het
Il1rl2 A T 1: 40,365,053 I445F possibly damaging Het
Ipo8 T C 6: 148,801,936 T400A probably benign Het
Iqsec3 T C 6: 121,473,289 E92G probably damaging Het
Itpr2 C T 6: 146,241,185 V1679M probably benign Het
Kif2a G A 13: 106,975,432 A478V probably damaging Het
Lingo4 A G 3: 94,402,033 S93G probably benign Het
Mrpl37 A G 4: 107,064,424 S203P possibly damaging Het
Ndel1 A C 11: 68,833,420 S242R probably damaging Het
Nfatc3 T A 8: 106,127,942 M1036K possibly damaging Het
Ngrn T C 7: 80,264,455 I118T probably damaging Het
Olfr975 A G 9: 39,950,375 V132A probably benign Het
Pex10 A T 4: 155,070,498 S236C probably damaging Het
Phkb T G 8: 85,942,391 probably null Het
Pklr A G 3: 89,141,908 Y187C probably damaging Het
Plekhh1 A C 12: 79,055,366 E403D probably benign Het
Pls1 T C 9: 95,795,768 K22E possibly damaging Het
Prdm2 G A 4: 143,134,954 H589Y possibly damaging Het
Rsph4a A G 10: 33,909,353 E420G probably benign Het
Sdk2 T C 11: 113,827,086 N1484S possibly damaging Het
St8sia3 T A 18: 64,266,985 V17E possibly damaging Het
Sult6b2 T A 6: 142,797,949 N117I probably damaging Het
Thbs2 T C 17: 14,681,701 T422A possibly damaging Het
Tmem266 A G 9: 55,437,329 D415G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttyh2 G T 11: 114,690,255 G107C probably damaging Het
Ubr4 A G 4: 139,440,814 D2835G probably damaging Het
Zranb3 T C 1: 127,976,462 D540G probably benign Het
Other mutations in Rabggtb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Rabggtb APN 3 153910259 critical splice donor site probably null
IGL01939:Rabggtb APN 3 153912013 missense probably damaging 0.98
R0348:Rabggtb UTSW 3 153910317 missense probably damaging 1.00
R3883:Rabggtb UTSW 3 153910780 missense probably damaging 1.00
R4884:Rabggtb UTSW 3 153911931 missense possibly damaging 0.66
R5220:Rabggtb UTSW 3 153909387 missense probably damaging 1.00
R7090:Rabggtb UTSW 3 153910349 missense probably benign 0.01
R7996:Rabggtb UTSW 3 153911968 missense probably damaging 1.00
Z1177:Rabggtb UTSW 3 153907685 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCTTTCTCACAAAGCAAGCTCC -3'
(R):5'- GCATTCCACTGTCGCATTGAACC -3'

Sequencing Primer
(F):5'- agacttcttgcctgtgcc -3'
(R):5'- CTGTCGCATTGAACCTACTAATAC -3'
Posted On2013-04-11