Incidental Mutation 'R1739:Kif14'
ID 200119
Institutional Source Beutler Lab
Gene Symbol Kif14
Ensembl Gene ENSMUSG00000041498
Gene Name kinesin family member 14
Synonyms N-3 kinesin, D1Ertd367e
MMRRC Submission 039771-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.947) question?
Stock # R1739 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 136394081-136459249 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 136443699 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 1291 (F1291L)
Ref Sequence ENSEMBL: ENSMUSP00000139698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047817] [ENSMUST00000189413] [ENSMUST00000201676]
AlphaFold L0N7N1
PDB Structure Crystal structure of the mouse Kif14 motor domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000047817
AA Change: F1241L

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000044257
Gene: ENSMUSG00000041498
AA Change: F1241L

DomainStartEndE-ValueType
KISc 341 694 1.45e-180 SMART
FHA 809 861 1.46e-7 SMART
coiled coil region 911 1060 N/A INTRINSIC
low complexity region 1169 1179 N/A INTRINSIC
low complexity region 1548 1559 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189413
AA Change: F1291L

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139698
Gene: ENSMUSG00000041498
AA Change: F1291L

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 744 1.45e-180 SMART
FHA 859 911 1.46e-7 SMART
coiled coil region 961 1110 N/A INTRINSIC
low complexity region 1219 1229 N/A INTRINSIC
low complexity region 1598 1609 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201676
SMART Domains Protein: ENSMUSP00000144265
Gene: ENSMUSG00000041498

DomainStartEndE-ValueType
low complexity region 278 290 N/A INTRINSIC
KISc 391 497 3.7e-6 SMART
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.8%
  • 10x: 94.9%
  • 20x: 91.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin-3 superfamily of microtubule motor proteins. These proteins are involved in numerous processes including vesicle transport, chromosome segregation, mitotic spindle formation, and cytokinesis. In human HeLa-S3 and 293T cells, this protein is localized to the cytoplasm during interphase, to the spindle poles and spindle microtubules during mitosis, and to the midbody during cytokinesis. An internal motor domain displays microtubule-dependent ATPase activity, consistent with its function as a microtubule motor protein. Knockdown of this gene results in failed cytokinesis with endoreplication, which results in multinucleated cells. This gene has been identified as a likely oncogene in breast, lung and ovarian cancers, as well as retinoblastomas and gliomas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a spontaneous mutation or targeted allele exhibit severe brain malformations, neurological defects and hypomyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 225 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 C T 7: 119,877,529 (GRCm39) T1059I probably benign Het
Abcb11 C T 2: 69,091,910 (GRCm39) A871T probably damaging Het
Acot7 T C 4: 152,345,369 (GRCm39) L313P probably damaging Het
Adam20 T A 8: 41,249,595 (GRCm39) H568Q probably benign Het
Adam26b T A 8: 43,974,714 (GRCm39) D96V probably damaging Het
Adgrf4 C T 17: 42,977,789 (GRCm39) R518Q possibly damaging Het
Apbb1 A G 7: 105,223,434 (GRCm39) V59A probably benign Het
Apc A G 18: 34,445,371 (GRCm39) K722E probably damaging Het
Aspm A G 1: 139,401,312 (GRCm39) I1111V probably benign Het
Aspscr1 A G 11: 120,569,342 (GRCm39) T47A probably damaging Het
Atr G A 9: 95,779,634 (GRCm39) V1331I probably benign Het
Baz1a G A 12: 54,945,573 (GRCm39) R1261* probably null Het
C2cd2l C A 9: 44,231,040 (GRCm39) R49L probably benign Het
C4bp C G 1: 130,570,725 (GRCm39) V284L probably benign Het
Cacna1c A C 6: 118,587,505 (GRCm39) M1287R probably damaging Het
Cacna1s T C 1: 136,046,454 (GRCm39) F1761S probably benign Het
Camsap2 C T 1: 136,209,053 (GRCm39) R802Q probably benign Het
Capn9 G A 8: 125,332,450 (GRCm39) G430R possibly damaging Het
Ccdc177 A G 12: 80,806,013 (GRCm39) V87A probably damaging Het
Ccdc178 T A 18: 22,230,780 (GRCm39) I364F possibly damaging Het
Ccdc93 C T 1: 121,383,855 (GRCm39) P192L probably benign Het
Ccdc93 T C 1: 121,389,668 (GRCm39) V237A probably benign Het
Cd55 C T 1: 130,377,160 (GRCm39) V333I probably benign Het
Cd55 C A 1: 130,387,370 (GRCm39) A143S probably benign Het
Cdh19 C A 1: 110,821,114 (GRCm39) E541D probably damaging Het
Cdh20 C G 1: 109,993,465 (GRCm39) L307V possibly damaging Het
Cep120 A G 18: 53,852,286 (GRCm39) probably null Het
Cep128 G T 12: 90,989,265 (GRCm39) probably null Het
Cep131 T C 11: 119,974,732 (GRCm39) I23V probably benign Het
Cfc1 A G 1: 34,576,315 (GRCm39) D125G probably damaging Het
Cfh T C 1: 140,064,526 (GRCm39) K374R probably benign Het
Cfh C T 1: 140,075,435 (GRCm39) V268I possibly damaging Het
Cfhr2 A G 1: 139,741,180 (GRCm39) M265T probably benign Het
Cfhr2 A C 1: 139,741,197 (GRCm39) N259K probably benign Het
Chi3l1 C T 1: 134,116,267 (GRCm39) A250V probably damaging Het
Clca3a1 C A 3: 144,713,539 (GRCm39) M697I probably benign Het
Clec4a3 C T 6: 122,931,000 (GRCm39) Q30* probably null Het
Cntnap3 T A 13: 64,888,406 (GRCm39) R1232S probably benign Het
Cntnap5a C T 1: 116,382,873 (GRCm39) T1047I probably benign Het
Cntnap5a C A 1: 116,382,734 (GRCm39) L1001I probably benign Het
Cntnap5a T C 1: 116,382,831 (GRCm39) L1033S probably benign Het
Col12a1 T A 9: 79,540,750 (GRCm39) I2412F probably damaging Het
Crb1 G A 1: 139,168,876 (GRCm39) P881S probably damaging Het
Crb1 C T 1: 139,170,733 (GRCm39) G825R probably damaging Het
Crb1 C T 1: 139,171,155 (GRCm39) R684H probably benign Het
Crb1 T C 1: 139,162,517 (GRCm39) M1214V probably benign Het
Crb1 A T 1: 139,165,360 (GRCm39) H921Q probably benign Het
Cxcl2 C T 5: 91,052,017 (GRCm39) T41I probably damaging Het
Cxcr4 C T 1: 128,517,014 (GRCm39) V216I probably benign Het
Cyb5r1 C T 1: 134,335,405 (GRCm39) R147W probably damaging Het
Ddx59 T C 1: 136,344,791 (GRCm39) V154A probably benign Het
Disp2 T C 2: 118,622,031 (GRCm39) V921A probably damaging Het
Dnajc10 C G 2: 80,178,006 (GRCm39) A671G probably benign Het
Dner T C 1: 84,348,505 (GRCm39) I732V probably damaging Het
Dsel T C 1: 111,787,187 (GRCm39) N1116S probably benign Het
Dsel G C 1: 111,787,724 (GRCm39) T937S probably benign Het
Dstyk C T 1: 132,384,722 (GRCm39) L739F probably damaging Het
Dysf T C 6: 84,089,217 (GRCm39) probably null Het
Eefsec T A 6: 88,353,187 (GRCm39) K161* probably null Het
Ehhadh G C 16: 21,581,003 (GRCm39) A663G probably benign Het
En1 A G 1: 120,531,350 (GRCm39) S197G unknown Het
Etnk2 C A 1: 133,293,325 (GRCm39) D89E probably benign Het
Etnk2 G T 1: 133,293,503 (GRCm39) G149W probably damaging Het
Etnk2 C T 1: 133,293,554 (GRCm39) R166* probably null Het
Etnk2 G A 1: 133,293,555 (GRCm39) R166Q probably benign Het
Etnk2 T A 1: 133,304,653 (GRCm39) V292E probably benign Het
Etnk2 A G 1: 133,291,661 (GRCm39) S54G probably benign Het
Exph5 T C 9: 53,286,888 (GRCm39) V1323A possibly damaging Het
Eya2 G T 2: 165,529,583 (GRCm39) G109W probably damaging Het
Fam72a C T 1: 131,466,633 (GRCm39) T139M probably benign Het
Fam72a T C 1: 131,458,406 (GRCm39) I56T probably benign Het
Fcamr A G 1: 130,739,317 (GRCm39) I206V probably benign Het
Fcamr G A 1: 130,740,366 (GRCm39) G262S probably benign Het
Fcamr A G 1: 130,740,429 (GRCm39) I283V probably benign Het
Fcamr T C 1: 130,740,475 (GRCm39) V298A probably benign Het
Fcamr A G 1: 130,740,546 (GRCm39) M322V probably benign Het
Fcamr C T 1: 130,740,553 (GRCm39) P324L probably benign Het
Fcamr A G 1: 130,742,334 (GRCm39) N574D probably benign Het
Fcamr A C 1: 130,732,364 (GRCm39) N117T probably benign Het
Fcmr T C 1: 130,806,006 (GRCm39) S321P probably benign Het
Fcmr A G 1: 130,803,711 (GRCm39) T172A probably benign Het
Focad T C 4: 88,316,128 (GRCm39) M1560T probably benign Het
Gadd45gip1 T A 8: 85,558,921 (GRCm39) M1K probably null Het
Gbgt1 T C 2: 28,395,064 (GRCm39) V234A possibly damaging Het
Gin1 T A 1: 97,713,829 (GRCm39) D376E probably damaging Het
Git1 A T 11: 77,389,808 (GRCm39) I24F probably damaging Het
Gli2 G T 1: 118,929,774 (GRCm39) H44Q probably benign Het
Gli2 C T 1: 118,795,817 (GRCm39) A113T possibly damaging Het
Gnptab T C 10: 88,271,957 (GRCm39) Y916H probably benign Het
Gpr25 G A 1: 136,188,448 (GRCm39) P55L probably benign Het
Heg1 T G 16: 33,558,953 (GRCm39) I1058S possibly damaging Het
Hivep3 A G 4: 119,952,371 (GRCm39) Y229C probably benign Het
Idi1 T C 13: 8,940,447 (GRCm39) F210L probably benign Het
Igfn1 T C 1: 135,926,421 (GRCm39) I10V unknown Het
Igfn1 T C 1: 135,926,363 (GRCm39) E29G probably benign Het
Igfn1 G A 1: 135,910,213 (GRCm39) R124W probably benign Het
Igfn1 C T 1: 135,907,653 (GRCm39) A231T probably benign Het
Igfn1 C T 1: 135,899,865 (GRCm39) R482Q probably benign Het
Igfn1 T C 1: 135,898,149 (GRCm39) S806G probably benign Het
Igfn1 G A 1: 135,895,937 (GRCm39) A1543V probably benign Het
Igfn1 G A 1: 135,887,666 (GRCm39) P2466L probably damaging Het
Ikbke T C 1: 131,197,560 (GRCm39) S447G probably benign Het
Ikbke C A 1: 131,193,674 (GRCm39) A459S probably benign Het
Ipo9 A G 1: 135,329,988 (GRCm39) V484A probably benign Het
Ipo9 ATCCTCCTCCTCCTCCTC ATCCTCCTCCTCCTCCTCCTC 1: 135,314,006 (GRCm39) probably benign Het
Jarid2 T A 13: 45,059,752 (GRCm39) N661K probably damaging Het
Kat7 T G 11: 95,167,373 (GRCm39) I455L possibly damaging Het
Kcnh5 G T 12: 75,161,003 (GRCm39) P302T probably damaging Het
Kcnt2 G A 1: 140,282,285 (GRCm39) S90N probably benign Het
Krtap12-1 C T 10: 77,556,826 (GRCm39) T123I possibly damaging Het
Ksr1 G A 11: 78,938,131 (GRCm39) T49I probably damaging Het
Lad1 C T 1: 135,755,761 (GRCm39) R346C probably damaging Het
Lad1 C T 1: 135,755,119 (GRCm39) P132S possibly damaging Het
Lat2 T C 5: 134,635,223 (GRCm39) H89R possibly damaging Het
Lax1 T C 1: 133,608,307 (GRCm39) N145D probably benign Het
Lax1 G A 1: 133,611,372 (GRCm39) P67S probably damaging Het
Lax1 T C 1: 133,607,716 (GRCm39) R342G probably benign Het
Lgr6 C T 1: 134,914,826 (GRCm39) V641I probably benign Het
Lgr6 A T 1: 134,915,747 (GRCm39) S334T probably benign Het
Lgr6 G T 1: 134,918,373 (GRCm39) H263N probably benign Het
Lgr6 C T 1: 134,931,214 (GRCm39) S3N probably benign Het
Lmod1 C T 1: 135,291,811 (GRCm39) T222I probably benign Het
Man2a2 T C 7: 80,012,186 (GRCm39) E657G probably benign Het
Mfsd4a C T 1: 131,995,621 (GRCm39) D4N possibly damaging Het
Mn1 G T 5: 111,567,880 (GRCm39) A617S possibly damaging Het
Mov10 T C 3: 104,707,598 (GRCm39) D592G probably damaging Het
Mroh3 G C 1: 136,119,882 (GRCm39) Q440E possibly damaging Het
Mtmr12 A T 15: 12,245,105 (GRCm39) T207S probably benign Het
Musk G A 4: 58,293,563 (GRCm39) V51M probably damaging Het
Mybph C T 1: 134,125,218 (GRCm39) R249C probably benign Het
Naglu C T 11: 100,967,229 (GRCm39) A393V possibly damaging Het
Nav1 A T 1: 135,512,465 (GRCm39) D198E possibly damaging Het
Ncan T A 8: 70,560,736 (GRCm39) T744S probably benign Het
Nlrp4c T A 7: 6,076,221 (GRCm39) V707E probably damaging Het
Nr5a2 C A 1: 136,879,863 (GRCm39) R35L probably benign Het
Nrcam A T 12: 44,618,458 (GRCm39) Q822L probably damaging Het
Obsl1 G A 1: 75,486,756 (GRCm38) T1764M probably benign Het
Optc A T 1: 133,831,534 (GRCm39) probably null Het
Optc C G 1: 133,832,908 (GRCm39) S64T probably benign Het
Or2f1 C A 6: 42,721,069 (GRCm39) L33M possibly damaging Het
Or4a68 C T 2: 89,269,927 (GRCm39) R232H probably benign Het
Or4c124 T A 2: 89,155,910 (GRCm39) I205F probably benign Het
Pak1 T A 7: 97,553,902 (GRCm39) V424E probably damaging Het
Pdcd6 G A 13: 74,452,160 (GRCm39) T160I probably damaging Het
Phf21a C T 2: 92,190,644 (GRCm39) T535M possibly damaging Het
Pigr C T 1: 130,772,259 (GRCm39) A159V possibly damaging Het
Pik3c2b C T 1: 132,994,365 (GRCm39) P110S probably benign Het
Pkdrej G A 15: 85,704,628 (GRCm39) T436I probably benign Het
Plekha6 C G 1: 133,215,584 (GRCm39) T792S probably benign Het
Ppip5k2 A T 1: 97,656,682 (GRCm39) H830Q probably damaging Het
Prelp C T 1: 133,842,869 (GRCm39) R92K probably benign Het
Ptpn7 A G 1: 135,062,213 (GRCm39) Q53R probably benign Het
Ptprc T G 1: 138,027,414 (GRCm39) N478T probably benign Het
Ptprc T C 1: 138,039,992 (GRCm39) K212E possibly damaging Het
Ptprc A G 1: 138,035,575 (GRCm39) V400A probably benign Het
Ptprc C A 1: 138,035,562 (GRCm39) E402D probably benign Het
Ptprc A G 1: 138,035,561 (GRCm39) S405P probably benign Het
Rab29 A G 1: 131,799,848 (GRCm39) Q141R probably benign Het
Ren1 C T 1: 133,281,975 (GRCm39) T32I probably benign Het
Ren1 T A 1: 133,281,944 (GRCm39) W22R probably damaging Het
Ren1 C G 1: 133,287,745 (GRCm39) L360V probably benign Het
Ren1 A T 1: 133,287,721 (GRCm39) N352Y probably benign Het
Ren1 A T 1: 133,286,817 (GRCm39) E315D probably benign Het
Ren1 A C 1: 133,284,195 (GRCm39) K187Q probably benign Het
Rnpep C T 1: 135,190,834 (GRCm39) A571T possibly damaging Het
Rnpep C G 1: 135,211,367 (GRCm39) R127P probably benign Het
Ro60 T C 1: 143,635,772 (GRCm39) D458G probably benign Het
Ro60 C T 1: 143,635,752 (GRCm39) V465I probably benign Het
Sctr T C 1: 119,959,386 (GRCm39) F110L probably benign Het
Sctr G A 1: 119,990,987 (GRCm39) S440N possibly damaging Het
Sctr G T 1: 119,990,976 (GRCm39) E453D probably benign Het
Sema4a A G 3: 88,344,145 (GRCm39) L702P possibly damaging Het
Septin4 A T 11: 87,474,262 (GRCm39) Q60L probably benign Het
Serpinb10 C T 1: 107,466,203 (GRCm39) S63F probably damaging Het
Serpinb2 G A 1: 107,443,365 (GRCm39) A55T probably damaging Het
Serpinb2 A C 1: 107,452,273 (GRCm39) S284R probably benign Het
Serpinb2 C T 1: 107,451,624 (GRCm39) T259I probably benign Het
Serpinb2 C T 1: 107,451,620 (GRCm39) H258Y probably benign Het
Serpinb2 C A 1: 107,451,564 (GRCm39) A239E probably benign Het
Serpinb8 A G 1: 107,525,257 (GRCm39) S20G probably benign Het
Serpinb8 A C 1: 107,534,734 (GRCm39) L268F probably benign Het
Serpinb8 G A 1: 107,526,684 (GRCm39) A75T probably benign Het
Shank2 A T 7: 143,733,590 (GRCm39) N482Y probably damaging Het
Shc3 A T 13: 51,636,952 (GRCm39) V72E probably damaging Het
Slc26a9 C T 1: 131,691,608 (GRCm39) A617V probably benign Het
Slc45a4 A G 15: 73,457,887 (GRCm39) I562T probably damaging Het
Smc6 T G 12: 11,367,854 (GRCm39) V1088G probably benign Het
Snx32 C A 19: 5,546,139 (GRCm39) R341L probably benign Het
Specc1 C T 11: 62,009,644 (GRCm39) Q467* probably null Het
Speer1c T C 5: 10,295,171 (GRCm39) I90V possibly damaging Het
Spock3 A T 8: 63,801,981 (GRCm39) N323I probably damaging Het
Stac3 A G 10: 127,343,635 (GRCm39) K259R probably benign Het
Steap3 G A 1: 120,162,108 (GRCm39) A350V probably benign Het
Steap3 T C 1: 120,155,480 (GRCm39) N493S probably benign Het
Stx3 A G 19: 11,762,887 (GRCm39) I163T probably damaging Het
Suco A G 1: 161,655,224 (GRCm39) probably null Het
Syngr4 A G 7: 45,538,146 (GRCm39) F74S possibly damaging Het
Synpo2l G A 14: 20,715,887 (GRCm39) P233S probably damaging Het
Tcf4 A T 18: 69,776,041 (GRCm39) T163S probably damaging Het
Thsd7b T A 1: 129,595,674 (GRCm39) F498Y probably benign Het
Thsd7b G C 1: 129,605,920 (GRCm39) A554P probably benign Het
Thsd7b A C 1: 130,044,368 (GRCm39) Q1116P probably benign Het
Thsd7b C T 1: 129,556,628 (GRCm39) T328I probably damaging Het
Tlk1 T C 2: 70,551,421 (GRCm39) Y634C probably damaging Het
Tnnt2 C T 1: 135,773,244 (GRCm39) probably benign Het
Tox2 T C 2: 163,089,705 (GRCm39) Y66H probably damaging Het
Ttn C T 2: 76,643,683 (GRCm39) G11436R probably damaging Het
Ttyh1 G A 7: 4,132,348 (GRCm39) M261I probably benign Het
Ubap2 A G 4: 41,206,849 (GRCm39) V509A probably benign Het
Ube2t C T 1: 134,899,905 (GRCm39) A149V probably benign Het
Ucp3 G C 7: 100,131,927 (GRCm39) M259I probably benign Het
Unc80 A T 1: 66,567,051 (GRCm39) N886Y probably damaging Het
Vmn1r197 T A 13: 22,512,541 (GRCm39) L154Q possibly damaging Het
Vmn1r40 T A 6: 89,691,297 (GRCm39) M38K probably benign Het
Vmn2r78 C A 7: 86,569,997 (GRCm39) Q172K probably benign Het
Ypel1 C G 16: 16,907,283 (GRCm39) probably benign Het
Zc3h11a C T 1: 133,552,359 (GRCm39) V583I probably benign Het
Zc3h11a G A 1: 133,549,892 (GRCm39) P695S probably benign Het
Zfhx4 A T 3: 5,466,790 (GRCm39) D2316V probably damaging Het
Zfp108 T C 7: 23,960,735 (GRCm39) V442A probably damaging Het
Zfp260 A T 7: 29,804,231 (GRCm39) T44S probably benign Het
Zfp873 C A 10: 81,896,541 (GRCm39) T424N probably damaging Het
Zp3r A G 1: 130,524,551 (GRCm39) L164P probably benign Het
Zp3r C A 1: 130,547,151 (GRCm39) E8D possibly damaging Het
Zswim2 T A 2: 83,745,684 (GRCm39) K585* probably null Het
Other mutations in Kif14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Kif14 APN 1 136,396,756 (GRCm39) missense probably benign 0.11
IGL00159:Kif14 APN 1 136,396,756 (GRCm39) missense probably benign 0.11
IGL00160:Kif14 APN 1 136,396,756 (GRCm39) missense probably benign 0.11
IGL00164:Kif14 APN 1 136,396,756 (GRCm39) missense probably benign 0.11
IGL00310:Kif14 APN 1 136,396,756 (GRCm39) missense probably benign 0.11
IGL00330:Kif14 APN 1 136,396,756 (GRCm39) missense probably benign 0.11
IGL00335:Kif14 APN 1 136,396,756 (GRCm39) missense probably benign 0.11
IGL00434:Kif14 APN 1 136,396,756 (GRCm39) missense probably benign 0.11
IGL00468:Kif14 APN 1 136,396,756 (GRCm39) missense probably benign 0.11
IGL01330:Kif14 APN 1 136,404,112 (GRCm39) missense probably damaging 0.99
IGL01530:Kif14 APN 1 136,406,157 (GRCm39) splice site probably benign
IGL01622:Kif14 APN 1 136,425,094 (GRCm39) splice site probably benign
IGL01689:Kif14 APN 1 136,447,380 (GRCm39) missense probably damaging 0.99
IGL02115:Kif14 APN 1 136,424,305 (GRCm39) splice site probably benign
IGL02252:Kif14 APN 1 136,406,130 (GRCm39) missense probably damaging 1.00
IGL02259:Kif14 APN 1 136,427,840 (GRCm39) missense probably benign
IGL02439:Kif14 APN 1 136,417,999 (GRCm39) missense probably damaging 1.00
IGL02590:Kif14 APN 1 136,423,742 (GRCm39) missense probably benign 0.00
IGL02606:Kif14 APN 1 136,424,331 (GRCm39) missense probably damaging 1.00
IGL03253:Kif14 APN 1 136,415,198 (GRCm39) missense probably damaging 0.97
R0106:Kif14 UTSW 1 136,407,662 (GRCm39) splice site probably benign
R0193:Kif14 UTSW 1 136,396,176 (GRCm39) missense probably benign 0.00
R0238:Kif14 UTSW 1 136,455,131 (GRCm39) missense probably damaging 0.99
R0238:Kif14 UTSW 1 136,455,131 (GRCm39) missense probably damaging 0.99
R0239:Kif14 UTSW 1 136,455,131 (GRCm39) missense probably damaging 0.99
R0239:Kif14 UTSW 1 136,455,131 (GRCm39) missense probably damaging 0.99
R0329:Kif14 UTSW 1 136,423,764 (GRCm39) splice site probably benign
R0346:Kif14 UTSW 1 136,395,898 (GRCm39) missense probably damaging 1.00
R0393:Kif14 UTSW 1 136,410,156 (GRCm39) missense probably damaging 1.00
R0519:Kif14 UTSW 1 136,396,885 (GRCm39) missense probably damaging 1.00
R0590:Kif14 UTSW 1 136,410,210 (GRCm39) missense probably damaging 0.97
R0633:Kif14 UTSW 1 136,455,043 (GRCm39) missense probably damaging 0.96
R0657:Kif14 UTSW 1 136,396,840 (GRCm39) missense probably benign 0.07
R0831:Kif14 UTSW 1 136,453,609 (GRCm39) splice site probably benign
R0971:Kif14 UTSW 1 136,447,392 (GRCm39) missense probably damaging 0.98
R1018:Kif14 UTSW 1 136,423,579 (GRCm39) splice site probably benign
R1520:Kif14 UTSW 1 136,431,062 (GRCm39) missense probably benign 0.00
R1713:Kif14 UTSW 1 136,455,202 (GRCm39) missense probably benign 0.00
R1728:Kif14 UTSW 1 136,396,017 (GRCm39) missense probably benign
R1728:Kif14 UTSW 1 136,453,521 (GRCm39) missense probably benign 0.03
R1728:Kif14 UTSW 1 136,443,699 (GRCm39) missense probably benign 0.04
R1728:Kif14 UTSW 1 136,431,169 (GRCm39) missense probably benign 0.10
R1728:Kif14 UTSW 1 136,418,070 (GRCm39) missense probably benign
R1728:Kif14 UTSW 1 136,406,103 (GRCm39) missense probably benign 0.00
R1728:Kif14 UTSW 1 136,396,713 (GRCm39) missense probably damaging 1.00
R1729:Kif14 UTSW 1 136,453,521 (GRCm39) missense probably benign 0.03
R1729:Kif14 UTSW 1 136,443,699 (GRCm39) missense probably benign 0.04
R1729:Kif14 UTSW 1 136,431,169 (GRCm39) missense probably benign 0.10
R1729:Kif14 UTSW 1 136,418,070 (GRCm39) missense probably benign
R1729:Kif14 UTSW 1 136,406,103 (GRCm39) missense probably benign 0.00
R1729:Kif14 UTSW 1 136,396,713 (GRCm39) missense probably damaging 1.00
R1729:Kif14 UTSW 1 136,396,017 (GRCm39) missense probably benign
R1730:Kif14 UTSW 1 136,396,713 (GRCm39) missense probably damaging 1.00
R1730:Kif14 UTSW 1 136,406,103 (GRCm39) missense probably benign 0.00
R1730:Kif14 UTSW 1 136,418,070 (GRCm39) missense probably benign
R1730:Kif14 UTSW 1 136,431,169 (GRCm39) missense probably benign 0.10
R1730:Kif14 UTSW 1 136,443,699 (GRCm39) missense probably benign 0.04
R1730:Kif14 UTSW 1 136,453,521 (GRCm39) missense probably benign 0.03
R1730:Kif14 UTSW 1 136,396,017 (GRCm39) missense probably benign
R1739:Kif14 UTSW 1 136,396,713 (GRCm39) missense probably damaging 1.00
R1739:Kif14 UTSW 1 136,406,103 (GRCm39) missense probably benign 0.00
R1739:Kif14 UTSW 1 136,418,070 (GRCm39) missense probably benign
R1739:Kif14 UTSW 1 136,431,169 (GRCm39) missense probably benign 0.10
R1739:Kif14 UTSW 1 136,453,521 (GRCm39) missense probably benign 0.03
R1739:Kif14 UTSW 1 136,396,017 (GRCm39) missense probably benign
R1762:Kif14 UTSW 1 136,406,103 (GRCm39) missense probably benign 0.00
R1762:Kif14 UTSW 1 136,418,070 (GRCm39) missense probably benign
R1762:Kif14 UTSW 1 136,431,169 (GRCm39) missense probably benign 0.10
R1762:Kif14 UTSW 1 136,443,699 (GRCm39) missense probably benign 0.04
R1762:Kif14 UTSW 1 136,396,713 (GRCm39) missense probably damaging 1.00
R1762:Kif14 UTSW 1 136,396,017 (GRCm39) missense probably benign
R1762:Kif14 UTSW 1 136,453,521 (GRCm39) missense probably benign 0.03
R1783:Kif14 UTSW 1 136,443,699 (GRCm39) missense probably benign 0.04
R1783:Kif14 UTSW 1 136,431,169 (GRCm39) missense probably benign 0.10
R1783:Kif14 UTSW 1 136,418,070 (GRCm39) missense probably benign
R1783:Kif14 UTSW 1 136,406,103 (GRCm39) missense probably benign 0.00
R1783:Kif14 UTSW 1 136,396,713 (GRCm39) missense probably damaging 1.00
R1783:Kif14 UTSW 1 136,396,017 (GRCm39) missense probably benign
R1783:Kif14 UTSW 1 136,453,521 (GRCm39) missense probably benign 0.03
R1784:Kif14 UTSW 1 136,396,713 (GRCm39) missense probably damaging 1.00
R1784:Kif14 UTSW 1 136,406,103 (GRCm39) missense probably benign 0.00
R1784:Kif14 UTSW 1 136,418,070 (GRCm39) missense probably benign
R1784:Kif14 UTSW 1 136,431,169 (GRCm39) missense probably benign 0.10
R1784:Kif14 UTSW 1 136,443,699 (GRCm39) missense probably benign 0.04
R1784:Kif14 UTSW 1 136,453,521 (GRCm39) missense probably benign 0.03
R1784:Kif14 UTSW 1 136,396,017 (GRCm39) missense probably benign
R1785:Kif14 UTSW 1 136,396,713 (GRCm39) missense probably damaging 1.00
R1785:Kif14 UTSW 1 136,406,103 (GRCm39) missense probably benign 0.00
R1785:Kif14 UTSW 1 136,418,070 (GRCm39) missense probably benign
R1785:Kif14 UTSW 1 136,431,169 (GRCm39) missense probably benign 0.10
R1785:Kif14 UTSW 1 136,443,699 (GRCm39) missense probably benign 0.04
R1785:Kif14 UTSW 1 136,453,521 (GRCm39) missense probably benign 0.03
R1785:Kif14 UTSW 1 136,396,017 (GRCm39) missense probably benign
R1872:Kif14 UTSW 1 136,414,096 (GRCm39) missense probably damaging 1.00
R2049:Kif14 UTSW 1 136,414,818 (GRCm39) missense probably benign
R2049:Kif14 UTSW 1 136,437,905 (GRCm39) missense possibly damaging 0.68
R2268:Kif14 UTSW 1 136,447,486 (GRCm39) nonsense probably null
R2373:Kif14 UTSW 1 136,407,583 (GRCm39) missense probably damaging 1.00
R3076:Kif14 UTSW 1 136,447,383 (GRCm39) missense possibly damaging 0.51
R3077:Kif14 UTSW 1 136,447,383 (GRCm39) missense possibly damaging 0.51
R3078:Kif14 UTSW 1 136,447,383 (GRCm39) missense possibly damaging 0.51
R4232:Kif14 UTSW 1 136,444,101 (GRCm39) nonsense probably null
R4246:Kif14 UTSW 1 136,401,126 (GRCm39) missense possibly damaging 0.80
R4247:Kif14 UTSW 1 136,401,126 (GRCm39) missense possibly damaging 0.80
R4250:Kif14 UTSW 1 136,401,126 (GRCm39) missense possibly damaging 0.80
R4672:Kif14 UTSW 1 136,449,016 (GRCm39) missense probably benign 0.00
R4672:Kif14 UTSW 1 136,449,017 (GRCm39) missense probably benign
R4890:Kif14 UTSW 1 136,414,868 (GRCm39) missense possibly damaging 0.91
R4994:Kif14 UTSW 1 136,410,697 (GRCm39) missense probably damaging 1.00
R5102:Kif14 UTSW 1 136,444,141 (GRCm39) missense probably benign 0.00
R5185:Kif14 UTSW 1 136,455,207 (GRCm39) nonsense probably null
R5201:Kif14 UTSW 1 136,431,145 (GRCm39) missense probably benign 0.00
R5399:Kif14 UTSW 1 136,431,062 (GRCm39) missense probably benign 0.00
R5431:Kif14 UTSW 1 136,424,433 (GRCm39) missense possibly damaging 0.91
R5932:Kif14 UTSW 1 136,444,128 (GRCm39) missense probably benign 0.23
R6027:Kif14 UTSW 1 136,410,797 (GRCm39) splice site probably null
R6246:Kif14 UTSW 1 136,404,162 (GRCm39) nonsense probably null
R6331:Kif14 UTSW 1 136,443,724 (GRCm39) missense probably null 1.00
R6448:Kif14 UTSW 1 136,431,085 (GRCm39) missense probably damaging 0.99
R6453:Kif14 UTSW 1 136,410,042 (GRCm39) splice site probably null
R6475:Kif14 UTSW 1 136,455,149 (GRCm39) missense probably damaging 1.00
R6631:Kif14 UTSW 1 136,443,697 (GRCm39) missense probably benign 0.39
R6713:Kif14 UTSW 1 136,453,544 (GRCm39) missense probably benign
R7173:Kif14 UTSW 1 136,406,908 (GRCm39) missense probably damaging 0.98
R7174:Kif14 UTSW 1 136,448,995 (GRCm39) missense possibly damaging 0.67
R7241:Kif14 UTSW 1 136,396,491 (GRCm39) missense probably benign 0.41
R7674:Kif14 UTSW 1 136,396,558 (GRCm39) missense probably damaging 0.99
R7688:Kif14 UTSW 1 136,422,392 (GRCm39) missense probably damaging 1.00
R7711:Kif14 UTSW 1 136,399,191 (GRCm39) missense probably benign 0.10
R7722:Kif14 UTSW 1 136,396,033 (GRCm39) missense probably benign 0.00
R7763:Kif14 UTSW 1 136,444,121 (GRCm39) missense probably benign 0.00
R7882:Kif14 UTSW 1 136,443,763 (GRCm39) missense probably benign 0.43
R7882:Kif14 UTSW 1 136,399,314 (GRCm39) critical splice donor site probably null
R8077:Kif14 UTSW 1 136,399,186 (GRCm39) missense possibly damaging 0.87
R8101:Kif14 UTSW 1 136,404,090 (GRCm39) missense probably benign 0.14
R8308:Kif14 UTSW 1 136,443,651 (GRCm39) missense possibly damaging 0.90
R8338:Kif14 UTSW 1 136,422,416 (GRCm39) missense probably damaging 1.00
R8527:Kif14 UTSW 1 136,396,495 (GRCm39) missense possibly damaging 0.95
R8542:Kif14 UTSW 1 136,396,495 (GRCm39) missense possibly damaging 0.95
R8884:Kif14 UTSW 1 136,414,089 (GRCm39) missense
R9435:Kif14 UTSW 1 136,401,174 (GRCm39) missense possibly damaging 0.92
R9499:Kif14 UTSW 1 136,455,219 (GRCm39) missense probably damaging 0.96
R9551:Kif14 UTSW 1 136,455,219 (GRCm39) missense probably damaging 0.96
R9577:Kif14 UTSW 1 136,399,138 (GRCm39) missense probably benign 0.00
X0021:Kif14 UTSW 1 136,418,014 (GRCm39) missense probably damaging 1.00
Z1176:Kif14 UTSW 1 136,427,754 (GRCm39) critical splice acceptor site probably null
Z1176:Kif14 UTSW 1 136,424,391 (GRCm39) missense probably damaging 0.97
Z1177:Kif14 UTSW 1 136,406,103 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCACTGATTCCTCAGTAACCTGC -3'
(R):5'- CAACCTGGATGGTAAGAGCCTGTG -3'

Sequencing Primer
(F):5'- TCAGTAACCTGCATCCACG -3'
(R):5'- CAGTTGCCATTGAAGCATCG -3'
Posted On 2014-05-23