Incidental Mutation 'R0088:Tmem266'
ID20014
Institutional Source Beutler Lab
Gene Symbol Tmem266
Ensembl Gene ENSMUSG00000032313
Gene Nametransmembrane protein 266
SynonymsAI118078
MMRRC Submission 038375-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0088 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location55326913-55438345 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55437329 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 415 (D415G)
Ref Sequence ENSEMBL: ENSMUSP00000034862 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034862] [ENSMUST00000085754]
Predicted Effect probably damaging
Transcript: ENSMUST00000034862
AA Change: D415G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034862
Gene: ENSMUSG00000032313
AA Change: D415G

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
transmembrane domain 95 117 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
transmembrane domain 172 191 N/A INTRINSIC
low complexity region 260 283 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
low complexity region 381 396 N/A INTRINSIC
low complexity region 423 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000085754
SMART Domains Protein: ENSMUSP00000082906
Gene: ENSMUSG00000032313

DomainStartEndE-ValueType
transmembrane domain 30 52 N/A INTRINSIC
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 195 218 N/A INTRINSIC
low complexity region 233 244 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130465
Meta Mutation Damage Score 0.4164 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 82% (32/39)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,914,067 K243R probably damaging Het
Akap9 C A 5: 3,961,946 T883K probably benign Het
Arhgap5 G T 12: 52,516,548 D101Y probably damaging Het
Bnc1 T G 7: 81,978,498 N39T possibly damaging Het
Carnmt1 T A 19: 18,677,853 H123Q probably benign Het
Cdh24 T C 14: 54,633,714 D92G probably damaging Het
Eomes A G 9: 118,478,673 E5G probably damaging Het
Eqtn T C 4: 94,919,990 T192A probably damaging Het
Fam110c T C 12: 31,075,218 V393A probably damaging Het
Fbll1 C A 11: 35,798,140 A99S possibly damaging Het
Il1rl2 A T 1: 40,365,053 I445F possibly damaging Het
Ipo8 T C 6: 148,801,936 T400A probably benign Het
Iqsec3 T C 6: 121,473,289 E92G probably damaging Het
Itpr2 C T 6: 146,241,185 V1679M probably benign Het
Kif2a G A 13: 106,975,432 A478V probably damaging Het
Lingo4 A G 3: 94,402,033 S93G probably benign Het
Mrpl37 A G 4: 107,064,424 S203P possibly damaging Het
Ndel1 A C 11: 68,833,420 S242R probably damaging Het
Nfatc3 T A 8: 106,127,942 M1036K possibly damaging Het
Ngrn T C 7: 80,264,455 I118T probably damaging Het
Olfr975 A G 9: 39,950,375 V132A probably benign Het
Pex10 A T 4: 155,070,498 S236C probably damaging Het
Phkb T G 8: 85,942,391 probably null Het
Pklr A G 3: 89,141,908 Y187C probably damaging Het
Plekhh1 A C 12: 79,055,366 E403D probably benign Het
Pls1 T C 9: 95,795,768 K22E possibly damaging Het
Prdm2 G A 4: 143,134,954 H589Y possibly damaging Het
Rabggtb C A 3: 153,908,830 R230L probably damaging Het
Rsph4a A G 10: 33,909,353 E420G probably benign Het
Sdk2 T C 11: 113,827,086 N1484S possibly damaging Het
St8sia3 T A 18: 64,266,985 V17E possibly damaging Het
Sult6b2 T A 6: 142,797,949 N117I probably damaging Het
Thbs2 T C 17: 14,681,701 T422A possibly damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttyh2 G T 11: 114,690,255 G107C probably damaging Het
Ubr4 A G 4: 139,440,814 D2835G probably damaging Het
Zranb3 T C 1: 127,976,462 D540G probably benign Het
Other mutations in Tmem266
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01726:Tmem266 APN 9 55435202 missense probably benign 0.12
IGL03366:Tmem266 APN 9 55437233 missense probably benign 0.06
R0418:Tmem266 UTSW 9 55437413 missense probably benign 0.06
R0497:Tmem266 UTSW 9 55380884 splice site probably null
R0763:Tmem266 UTSW 9 55414955 missense probably damaging 1.00
R1657:Tmem266 UTSW 9 55418008 missense probably damaging 1.00
R3617:Tmem266 UTSW 9 55400634 missense probably damaging 0.99
R4235:Tmem266 UTSW 9 55418107 missense probably damaging 0.99
R4767:Tmem266 UTSW 9 55380741 missense probably damaging 1.00
R5587:Tmem266 UTSW 9 55437566 missense probably damaging 1.00
R5732:Tmem266 UTSW 9 55380836 missense probably damaging 1.00
R5783:Tmem266 UTSW 9 55397803 missense probably damaging 1.00
R6193:Tmem266 UTSW 9 55437209 missense probably benign 0.01
R6943:Tmem266 UTSW 9 55377567 start gained probably benign
R7459:Tmem266 UTSW 9 55396599 missense unknown
X0063:Tmem266 UTSW 9 55380749 missense probably benign 0.00
Z1177:Tmem266 UTSW 9 55397767 missense probably damaging 1.00
Z1177:Tmem266 UTSW 9 55437470 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- ACCTCTCTGGCCTTCAAAGTGACG -3'
(R):5'- GTTGAACAGACTCACCCTATGCTCC -3'

Sequencing Primer
(F):5'- ggaggcaaaagcaggcag -3'
(R):5'- TCTGGACTGAGCCCAGTG -3'
Posted On2013-04-11