Incidental Mutation 'R0088:Sdk2'
ID 20019
Institutional Source Beutler Lab
Gene Symbol Sdk2
Ensembl Gene ENSMUSG00000041592
Gene Name sidekick cell adhesion molecule 2
Synonyms 5330435L01Rik, 4632412F08Rik
MMRRC Submission 038375-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R0088 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 11
Chromosomal Location 113776374-114067046 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113827086 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1484 (N1484S)
Ref Sequence ENSEMBL: ENSMUSP00000038972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041627]
AlphaFold Q6V4S5
Predicted Effect possibly damaging
Transcript: ENSMUST00000041627
AA Change: N1484S

PolyPhen 2 Score 0.741 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038972
Gene: ENSMUSG00000041592
AA Change: N1484S

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGc2 43 102 4.67e-4 SMART
IG 123 208 6.07e-3 SMART
IG 225 309 1.4e-7 SMART
IGc2 325 391 6.21e-9 SMART
IGc2 418 486 8.57e-12 SMART
IG 506 591 2.37e-5 SMART
FN3 594 678 1.91e-7 SMART
FN3 694 780 2.42e-9 SMART
FN3 796 884 3.45e-5 SMART
FN3 899 981 2.36e-12 SMART
FN3 997 1084 1.64e-6 SMART
FN3 1101 1188 8.83e-12 SMART
FN3 1204 1289 3.62e-8 SMART
FN3 1305 1388 1.74e-10 SMART
FN3 1404 1489 8.23e-12 SMART
FN3 1506 1612 3.62e-8 SMART
FN3 1628 1713 1.15e-10 SMART
FN3 1728 1815 2.17e-11 SMART
FN3 1829 1913 5.04e-7 SMART
transmembrane domain 1935 1957 N/A INTRINSIC
low complexity region 2138 2153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125879
Meta Mutation Damage Score 0.8194 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 82% (32/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily. The protein contains two immunoglobulin domains and thirteen fibronectin type III domains. Fibronectin type III domains are present in both extracellular and intracellular proteins and tandem repeats are known to contain binding sites for DNA, heparin and the cell surface. This protein, and a homologous mouse sequence, are very similar to the Drosophila sidekick gene product but the specific function of this superfamily member is not yet known. Evidence for alternative splicing at this gene locus has been observed but the full-length nature of additional variants has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired interconnectvity between VG3 amacrine cells and W3B retinal ganglion cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,914,067 K243R probably damaging Het
Akap9 C A 5: 3,961,946 T883K probably benign Het
Arhgap5 G T 12: 52,516,548 D101Y probably damaging Het
Bnc1 T G 7: 81,978,498 N39T possibly damaging Het
Carnmt1 T A 19: 18,677,853 H123Q probably benign Het
Cdh24 T C 14: 54,633,714 D92G probably damaging Het
Eomes A G 9: 118,478,673 E5G probably damaging Het
Eqtn T C 4: 94,919,990 T192A probably damaging Het
Fam110c T C 12: 31,075,218 V393A probably damaging Het
Fbll1 C A 11: 35,798,140 A99S possibly damaging Het
Il1rl2 A T 1: 40,365,053 I445F possibly damaging Het
Ipo8 T C 6: 148,801,936 T400A probably benign Het
Iqsec3 T C 6: 121,473,289 E92G probably damaging Het
Itpr2 C T 6: 146,241,185 V1679M probably benign Het
Kif2a G A 13: 106,975,432 A478V probably damaging Het
Lingo4 A G 3: 94,402,033 S93G probably benign Het
Mrpl37 A G 4: 107,064,424 S203P possibly damaging Het
Ndel1 A C 11: 68,833,420 S242R probably damaging Het
Nfatc3 T A 8: 106,127,942 M1036K possibly damaging Het
Ngrn T C 7: 80,264,455 I118T probably damaging Het
Olfr975 A G 9: 39,950,375 V132A probably benign Het
Pex10 A T 4: 155,070,498 S236C probably damaging Het
Phkb T G 8: 85,942,391 probably null Het
Pklr A G 3: 89,141,908 Y187C probably damaging Het
Plekhh1 A C 12: 79,055,366 E403D probably benign Het
Pls1 T C 9: 95,795,768 K22E possibly damaging Het
Prdm2 G A 4: 143,134,954 H589Y possibly damaging Het
Rabggtb C A 3: 153,908,830 R230L probably damaging Het
Rsph4a A G 10: 33,909,353 E420G probably benign Het
St8sia3 T A 18: 64,266,985 V17E possibly damaging Het
Sult6b2 T A 6: 142,797,949 N117I probably damaging Het
Thbs2 T C 17: 14,681,701 T422A possibly damaging Het
Tmem266 A G 9: 55,437,329 D415G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttyh2 G T 11: 114,690,255 G107C probably damaging Het
Ubr4 A G 4: 139,440,814 D2835G probably damaging Het
Zranb3 T C 1: 127,976,462 D540G probably benign Het
Other mutations in Sdk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00972:Sdk2 APN 11 113854384 missense possibly damaging 0.86
IGL01063:Sdk2 APN 11 113830842 missense probably damaging 1.00
IGL01291:Sdk2 APN 11 113843080 missense probably benign
IGL01316:Sdk2 APN 11 113867965 missense probably benign 0.09
IGL01614:Sdk2 APN 11 113793858 missense probably damaging 1.00
IGL01998:Sdk2 APN 11 113838532 missense probably damaging 0.98
IGL02014:Sdk2 APN 11 113838494 missense probably damaging 1.00
IGL02095:Sdk2 APN 11 113834830 missense probably damaging 1.00
IGL02115:Sdk2 APN 11 113834813 splice site probably benign
IGL02543:Sdk2 APN 11 113868921 missense possibly damaging 0.90
IGL02976:Sdk2 APN 11 113851842 missense probably damaging 1.00
IGL03001:Sdk2 APN 11 113821626 missense probably benign 0.00
IGL03122:Sdk2 APN 11 113842068 missense probably damaging 1.00
IGL03183:Sdk2 APN 11 113850984 missense probably benign 0.19
IGL03222:Sdk2 APN 11 113838431 missense probably benign 0.01
IGL03310:Sdk2 APN 11 113793325 missense possibly damaging 0.77
Curtailed UTSW 11 113851800 missense probably damaging 1.00
Trimmed UTSW 11 113856696 nonsense probably null
ANU05:Sdk2 UTSW 11 113843080 missense probably benign
BB008:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
BB018:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0008:Sdk2 UTSW 11 113856755 missense probably damaging 1.00
R0096:Sdk2 UTSW 11 113903144 splice site probably benign
R0386:Sdk2 UTSW 11 113893464 missense probably damaging 0.96
R0396:Sdk2 UTSW 11 113829967 missense probably benign 0.04
R0409:Sdk2 UTSW 11 113850891 splice site probably benign
R0416:Sdk2 UTSW 11 113803203 missense probably damaging 1.00
R0456:Sdk2 UTSW 11 113791466 missense possibly damaging 0.93
R0544:Sdk2 UTSW 11 113781010 missense probably damaging 1.00
R0691:Sdk2 UTSW 11 113794920 splice site probably null
R0711:Sdk2 UTSW 11 113903144 splice site probably benign
R0717:Sdk2 UTSW 11 113832326 missense probably damaging 1.00
R0780:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R0831:Sdk2 UTSW 11 113832258 missense probably damaging 0.96
R0853:Sdk2 UTSW 11 113821415 missense probably benign 0.00
R0865:Sdk2 UTSW 11 113850922 missense probably benign 0.12
R0930:Sdk2 UTSW 11 113838445 missense probably benign 0.01
R0964:Sdk2 UTSW 11 113806417 splice site probably benign
R1051:Sdk2 UTSW 11 113838646 synonymous silent
R1052:Sdk2 UTSW 11 113838646 synonymous silent
R1054:Sdk2 UTSW 11 113838646 synonymous silent
R1055:Sdk2 UTSW 11 113838646 synonymous silent
R1077:Sdk2 UTSW 11 113838646 synonymous silent
R1079:Sdk2 UTSW 11 113838646 synonymous silent
R1115:Sdk2 UTSW 11 113838646 synonymous silent
R1186:Sdk2 UTSW 11 113838646 synonymous silent
R1187:Sdk2 UTSW 11 113838646 synonymous silent
R1337:Sdk2 UTSW 11 113832331 missense possibly damaging 0.79
R1430:Sdk2 UTSW 11 113838646 synonymous silent
R1433:Sdk2 UTSW 11 113795045 missense probably damaging 0.99
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1464:Sdk2 UTSW 11 113830080 missense possibly damaging 0.86
R1497:Sdk2 UTSW 11 113893575 splice site probably benign
R1514:Sdk2 UTSW 11 113838646 synonymous silent
R1529:Sdk2 UTSW 11 113838646 synonymous silent
R1596:Sdk2 UTSW 11 113838609 splice site probably benign
R1680:Sdk2 UTSW 11 113791436 missense possibly damaging 0.47
R1680:Sdk2 UTSW 11 113838646 synonymous silent
R1770:Sdk2 UTSW 11 113793741 missense probably benign 0.05
R1858:Sdk2 UTSW 11 113838646 synonymous silent
R1866:Sdk2 UTSW 11 113838646 synonymous silent
R1874:Sdk2 UTSW 11 113834956 missense probably benign 0.00
R1899:Sdk2 UTSW 11 113838646 synonymous silent
R1905:Sdk2 UTSW 11 113838646 synonymous silent
R1907:Sdk2 UTSW 11 113838646 synonymous silent
R1913:Sdk2 UTSW 11 113856726 missense possibly damaging 0.77
R1964:Sdk2 UTSW 11 113781017 nonsense probably null
R2055:Sdk2 UTSW 11 113850954 missense probably damaging 1.00
R2059:Sdk2 UTSW 11 113854332 missense probably damaging 1.00
R2093:Sdk2 UTSW 11 113943122 missense probably damaging 1.00
R2256:Sdk2 UTSW 11 113830794 missense probably benign 0.44
R3720:Sdk2 UTSW 11 113800244 missense probably damaging 1.00
R3795:Sdk2 UTSW 11 113856696 nonsense probably null
R4037:Sdk2 UTSW 11 113795055 missense probably damaging 1.00
R4171:Sdk2 UTSW 11 113866989 splice site probably null
R4717:Sdk2 UTSW 11 113854369 missense probably damaging 0.96
R4758:Sdk2 UTSW 11 113827054 missense possibly damaging 0.87
R4857:Sdk2 UTSW 11 113821382 nonsense probably null
R4924:Sdk2 UTSW 11 113857758 missense probably damaging 1.00
R5015:Sdk2 UTSW 11 113793761 missense probably damaging 1.00
R5171:Sdk2 UTSW 11 113850982 missense probably benign 0.01
R5239:Sdk2 UTSW 11 113868033 missense probably damaging 1.00
R5243:Sdk2 UTSW 11 113825086 missense possibly damaging 0.76
R5279:Sdk2 UTSW 11 113867031 missense probably benign 0.31
R5535:Sdk2 UTSW 11 113943158 missense possibly damaging 0.80
R5634:Sdk2 UTSW 11 113851714 missense probably damaging 1.00
R5637:Sdk2 UTSW 11 113833179 missense probably damaging 1.00
R5726:Sdk2 UTSW 11 113851800 missense probably damaging 1.00
R5793:Sdk2 UTSW 11 113868952 missense possibly damaging 0.46
R5798:Sdk2 UTSW 11 113827116 missense probably damaging 1.00
R5834:Sdk2 UTSW 11 113854273 missense probably damaging 1.00
R5863:Sdk2 UTSW 11 113834984 missense probably damaging 0.98
R5869:Sdk2 UTSW 11 113851882 missense probably damaging 0.96
R5875:Sdk2 UTSW 11 113830059 missense probably benign 0.00
R5953:Sdk2 UTSW 11 113793744 missense probably damaging 1.00
R5991:Sdk2 UTSW 11 113943254 missense probably damaging 0.97
R6018:Sdk2 UTSW 11 113830063 missense probably benign 0.00
R6116:Sdk2 UTSW 11 113854364 missense probably damaging 0.99
R6328:Sdk2 UTSW 11 113793755 missense probably damaging 1.00
R6348:Sdk2 UTSW 11 113893508 missense probably benign 0.07
R6383:Sdk2 UTSW 11 113832265 missense probably damaging 1.00
R6824:Sdk2 UTSW 11 113867934 missense probably benign 0.43
R6835:Sdk2 UTSW 11 113830048 missense probably damaging 0.98
R6853:Sdk2 UTSW 11 113780929 missense probably damaging 0.99
R6912:Sdk2 UTSW 11 113903120 missense probably benign 0.03
R7000:Sdk2 UTSW 11 113803169 missense probably damaging 1.00
R7099:Sdk2 UTSW 11 113834905 missense probably damaging 0.98
R7102:Sdk2 UTSW 11 113842690 nonsense probably null
R7177:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7381:Sdk2 UTSW 11 113838489 missense probably damaging 0.98
R7412:Sdk2 UTSW 11 113868083 splice site probably null
R7504:Sdk2 UTSW 11 113867967 missense possibly damaging 0.50
R7552:Sdk2 UTSW 11 113873213 missense possibly damaging 0.63
R7604:Sdk2 UTSW 11 113829969 missense possibly damaging 0.91
R7647:Sdk2 UTSW 11 113793737 missense probably damaging 1.00
R7897:Sdk2 UTSW 11 113873201 missense possibly damaging 0.50
R7931:Sdk2 UTSW 11 113893441 missense possibly damaging 0.79
R7998:Sdk2 UTSW 11 113859938 missense probably benign 0.18
R8052:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8053:Sdk2 UTSW 11 113854351 missense probably damaging 1.00
R8084:Sdk2 UTSW 11 113827089 missense possibly damaging 0.67
R8136:Sdk2 UTSW 11 113851713 missense probably damaging 1.00
R8151:Sdk2 UTSW 11 113872857 missense possibly damaging 0.84
R8394:Sdk2 UTSW 11 113838716 missense probably benign
R8715:Sdk2 UTSW 11 113780902 missense probably damaging 1.00
R8774:Sdk2 UTSW 11 113839343 missense probably damaging 1.00
R8774-TAIL:Sdk2 UTSW 11 113839343 missense probably damaging 1.00
R8804:Sdk2 UTSW 11 113873152 nonsense probably null
R9136:Sdk2 UTSW 11 113806377 missense probably damaging 1.00
R9147:Sdk2 UTSW 11 113823400 missense probably benign 0.18
R9300:Sdk2 UTSW 11 113825030 missense possibly damaging 0.63
R9354:Sdk2 UTSW 11 113834931 missense probably benign 0.00
R9450:Sdk2 UTSW 11 113806279 missense probably benign
R9462:Sdk2 UTSW 11 113869918 missense possibly damaging 0.56
R9616:Sdk2 UTSW 11 113800235 missense probably benign 0.05
R9678:Sdk2 UTSW 11 113794963 nonsense probably null
RF002:Sdk2 UTSW 11 113885252 missense probably benign 0.00
V1662:Sdk2 UTSW 11 113834908 missense probably damaging 1.00
Z1176:Sdk2 UTSW 11 113839322 missense probably benign 0.41
Z1176:Sdk2 UTSW 11 113851836 missense probably damaging 0.97
Z1177:Sdk2 UTSW 11 113838659 missense probably damaging 0.99
Z1177:Sdk2 UTSW 11 113839320 missense probably damaging 1.00
Z1177:Sdk2 UTSW 11 113859956 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGTGAGCCATCTCTCACCGACAG -3'
(R):5'- TCAAGCAGGAATGGATGAGACCCC -3'

Sequencing Primer
(F):5'- ATCTCTCACCGACAGGGGTC -3'
(R):5'- gtcccagtgatgtgcttcc -3'
Posted On 2013-04-11