Mutagenetix > Incidental Mutation

Incidental Mutation 'R1740:Raph1'

200246

Institutional Source

Beutler Lab

Gene Symbol

Raph1

Ensembl Gene

ENSMUSG00000026014

Gene Name

Ras association (RalGDS/AF-6) and pleckstrin homology domains 1

Synonyms

C730009O10Rik, Lpd, 9430025M21Rik, lamellipodin

MMRRC Submission

039772-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.136) question?

Stock #

R1740 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60482292-60567104 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 60519024 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Stop codon at position 258 (K258*)

Ref Sequence

ENSEMBL: ENSMUSP00000087763 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027168] [ENSMUST00000090293] [ENSMUST00000140485]

AlphaFold

F2Z3U3

Predicted Effect

probably null
Transcript: ENSMUST00000027168
AA Change: K258*

SMART Domains

Protein: ENSMUSP00000027168
Gene: ENSMUSG00000026014
AA Change: K258*

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000090293
AA Change: K258*

SMART Domains

Protein: ENSMUSP00000087763
Gene: ENSMUSG00000026014
AA Change: K258*

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	294	308	N/A	INTRINSIC
RA	322	408	1.63e-13	SMART
PH	450	560	3.38e-11	SMART
low complexity region	581	604	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000122243

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127573

SMART Domains

Protein: ENSMUSP00000114596
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
coiled coil region	295	320	N/A	INTRINSIC
RA	322	408	1e-15	SMART
PH	450	560	1.6e-13	SMART
low complexity region	581	604	N/A	INTRINSIC
low complexity region	656	661	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140485

SMART Domains

Protein: ENSMUSP00000121023
Gene: ENSMUSG00000026014

Domain	Start	End	E-Value	Type
low complexity region	201	218	N/A	INTRINSIC
low complexity region	245	256	N/A	INTRINSIC
RA	270	356	1.63e-13	SMART
PH	398	508	3.38e-11	SMART
low complexity region	529	552	N/A	INTRINSIC

Meta Mutation Damage Score

0.9632

Coding Region Coverage

1x: 97.5%
3x: 97.0%
10x: 95.5%
20x: 93.0%

Validation Efficiency

99% (69/70)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the Mig10/Rap1-interacting adaptor molecule/Lamellipodin family of adapter proteins, which function in cell migration. Members of this family contain pleckstrin-homology domains, Ras-association domains, and proline-rich C-termini. The protein encoded by this gene regulates actin dynamics through interaction with Ena/Vasodilator proteins as well as direct binding to filamentous actin to regulate actin network assembly. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a conditional allele activated in all cells exhibit background sensitive neonatal or postnatal lethality, decreased body size, belly spotting and decreased melanocyte numbers in the trunk. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610021A01Rik	T	A	7: 41,626,125	C417*	probably null	Het
4930548G14Rik	G	A	15: 46,625,489		noncoding transcript	Het
Abcc12	T	A	8: 86,505,497	K1311*	probably null	Het
Abcc12	T	C	8: 86,509,771	D1138G	possibly damaging	Het
Adam32	A	G	8: 24,921,298	S116P	probably damaging	Het
Arhgef26	C	T	3: 62,423,583	L39F	probably damaging	Het
Babam1	T	C	8: 71,403,019	I252T	probably damaging	Het
Btf3	C	T	13: 98,316,296	M1I	probably null	Het
Ccdc109b	A	T	3: 129,918,727	H166Q	probably benign	Het
Ccdc61	G	T	7: 18,903,937		probably benign	Het
Ccdc89	C	T	7: 90,426,738	S52F	probably damaging	Het
Cds2	T	A	2: 132,302,213	I320N	possibly damaging	Het
Cebpe	T	C	14: 54,711,942	Y6C	probably damaging	Het
Cep250	T	A	2: 155,973,356	I598N	probably damaging	Het
Cep350	T	A	1: 155,928,833	I835F	probably damaging	Het
Ces3a	T	C	8: 105,048,685	L22P	probably damaging	Het
Cfap221	T	C	1: 119,945,828	S490G	probably benign	Het
Cyp2j11	A	G	4: 96,319,376	V234A	probably benign	Het
Dgat1	T	C	15: 76,502,729	H399R	probably damaging	Het
Dnah10	A	T	5: 124,773,190		probably null	Het
Ebpl	T	G	14: 61,341,207	K193T	probably benign	Het
Elmsan1	T	C	12: 84,172,902	E426G	probably damaging	Het
Entpd5	T	C	12: 84,396,771	N66S	probably benign	Het
Fcgbp	G	T	7: 28,101,249	G1240V	possibly damaging	Het
Gabra5	A	G	7: 57,421,842	S209P	probably benign	Het
Glce	A	T	9: 62,070,533	V23D	probably damaging	Het
Gm14226	GACTGTTAC	GAC	2: 155,024,931		probably benign	Het
Gtf2h1	A	G	7: 46,812,466	N296S	probably null	Het
Herc6	T	C	6: 57,652,065	S654P	probably benign	Het
Kcnk3	A	T	5: 30,621,977	M124L	possibly damaging	Het
Lamb2	T	G	9: 108,481,928	V281G	probably damaging	Het
Lctl	A	T	9: 64,133,107	D444V	probably damaging	Het
Mcm2	A	G	6: 88,884,044	F891L	probably damaging	Het
Mical2	G	T	7: 112,333,836	R739L	probably benign	Het
Mkrn2	G	T	6: 115,613,369	A229S	probably damaging	Het
Mmp7	A	G	9: 7,695,277	Y80C	possibly damaging	Het
Mpp2	T	C	11: 102,062,396		probably null	Het
Msh6	C	A	17: 87,985,722	T635K	possibly damaging	Het
Mvd	T	A	8: 122,436,547	T315S	probably benign	Het
Myocd	C	T	11: 65,218,521		probably benign	Het
Nav1	C	T	1: 135,458,389		probably null	Het
Olfr1298	T	A	2: 111,645,869	I43F	probably damaging	Het
Pde4b	A	T	4: 102,487,351	D141V	probably damaging	Het
Pdgfrb	A	T	18: 61,081,833	D978V	possibly damaging	Het
Prss55	T	C	14: 64,075,680	T252A	probably damaging	Het
Psd3	A	T	8: 68,120,839	V230E	probably damaging	Het
Ptk2	A	G	15: 73,242,406	V701A	possibly damaging	Het
Ptprn	A	G	1: 75,262,050	V82A	probably damaging	Het
Ptpru	G	T	4: 131,793,678		probably null	Het
Rnf25	A	G	1: 74,598,727	V28A	probably damaging	Het
Slc25a4	C	T	8: 46,208,503	V212M	probably benign	Het
Slc39a3	T	C	10: 81,031,508	S135G	probably damaging	Het
Slco6d1	A	G	1: 98,428,372	I220M	probably damaging	Het
Smim19	G	T	8: 22,473,528	Y21*	probably null	Het
Speer4f1	A	C	5: 17,478,761	Y141S	probably damaging	Het
Srgap2	G	A	1: 131,289,388	P1062L	probably benign	Het
Stra8	A	T	6: 34,927,719		probably benign	Het
Timm21	G	C	18: 84,949,262	L130V	probably damaging	Het
Tmem40	A	G	6: 115,738,999	S76P	probably benign	Het
Unc13b	C	T	4: 43,240,285	R3569W	probably damaging	Het
Vmn1r128	A	T	7: 21,349,944	Q191L	probably benign	Het
Washc2	T	A	6: 116,231,632		probably benign	Het

Other mutations in Raph1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02300:Raph1	APN	1	60525947	missense	possibly damaging	0.76
IGL02900:Raph1	APN	1	60502863	missense	probably damaging	1.00
FR4976:Raph1	UTSW	1	60489267	intron	probably benign
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0048:Raph1	UTSW	1	60500605	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0049:Raph1	UTSW	1	60525899	missense	probably benign	0.03
R0227:Raph1	UTSW	1	60525977	missense	probably benign	0.00
R0387:Raph1	UTSW	1	60510496	intron	probably benign
R0607:Raph1	UTSW	1	60525869	missense	probably damaging	1.00
R2274:Raph1	UTSW	1	60498500	missense	probably damaging	1.00
R3108:Raph1	UTSW	1	60493386	missense	probably benign	0.01
R3977:Raph1	UTSW	1	60498523	missense	probably benign	0.39
R4260:Raph1	UTSW	1	60502965	missense	possibly damaging	0.94
R4487:Raph1	UTSW	1	60502869	missense	possibly damaging	0.68
R4721:Raph1	UTSW	1	60503001	unclassified	probably benign
R4782:Raph1	UTSW	1	60489114	missense	probably damaging	1.00
R5027:Raph1	UTSW	1	60496277	missense	probably damaging	1.00
R5037:Raph1	UTSW	1	60496222	splice site	probably null
R5106:Raph1	UTSW	1	60533300	missense	probably damaging	1.00
R5506:Raph1	UTSW	1	60493498	intron	probably benign
R5510:Raph1	UTSW	1	60522946	unclassified	probably benign
R5587:Raph1	UTSW	1	60498473	missense	probably damaging	1.00
R5591:Raph1	UTSW	1	60501746	unclassified	probably benign
R5619:Raph1	UTSW	1	60490255	intron	probably benign
R5776:Raph1	UTSW	1	60490156	intron	probably benign
R5802:Raph1	UTSW	1	60488673	missense	possibly damaging	0.81
R6742:Raph1	UTSW	1	60525720	missense	probably damaging	0.97
R7122:Raph1	UTSW	1	60525977	missense	probably benign	0.10
R7219:Raph1	UTSW	1	60502873	missense	unknown
R7251:Raph1	UTSW	1	60489868	missense	unknown
R7254:Raph1	UTSW	1	60499608	missense	unknown
R7732:Raph1	UTSW	1	60533288	missense	possibly damaging	0.82
R7979:Raph1	UTSW	1	60525989	missense	probably benign	0.00
R7986:Raph1	UTSW	1	60496286	missense
R8167:Raph1	UTSW	1	60490111	missense	unknown
R8168:Raph1	UTSW	1	60499620	missense	unknown
R8399:Raph1	UTSW	1	60489318	missense	unknown
R9036:Raph1	UTSW	1	60502965	missense	unknown
R9146:Raph1	UTSW	1	60518978	critical splice donor site	probably null
R9338:Raph1	UTSW	1	60490141	missense	unknown
R9381:Raph1	UTSW	1	60501800	missense	unknown
R9383:Raph1	UTSW	1	60525670	missense	unknown
R9399:Raph1	UTSW	1	60525995	missense	probably benign
R9454:Raph1	UTSW	1	60489594	missense	unknown
R9561:Raph1	UTSW	1	60525728	missense	possibly damaging	0.49
RF018:Raph1	UTSW	1	60489267	intron	probably benign
RF022:Raph1	UTSW	1	60489267	intron	probably benign

Predicted Primers

PCR Primer
(F):5'- TGTAGAATCTAATGTGAAGCTCCACAGC -3'
(R):5'- GCATACACTGCTTCTGGACAACATGG -3'

Sequencing Primer
(F):5'- tttgtttgtttgtttgcttgtttg -3'
(R):5'- CAACATGGCTGCGAAGGTC -3'

Posted On

2014-05-23