Incidental Mutation 'R1740:Cep350'
ID200254
Institutional Source Beutler Lab
Gene Symbol Cep350
Ensembl Gene ENSMUSG00000033671
Gene Namecentrosomal protein 350
Synonyms6430546F08Rik, 4933409L06Rik
MMRRC Submission 039772-MU
Accession Numbers

Genbank: NM_001039184.1; Ensembl: ENSMUST00000138762, ENSMUST00000124495, ENSMUST00000078888

Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R1740 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location155844964-155973255 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 155928833 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 835 (I835F)
Ref Sequence ENSEMBL: ENSMUSP00000120085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138762]
Predicted Effect probably damaging
Transcript: ENSMUST00000138762
AA Change: I835F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120085
Gene: ENSMUSG00000033671
AA Change: I835F

DomainStartEndE-ValueType
low complexity region 251 265 N/A INTRINSIC
low complexity region 376 394 N/A INTRINSIC
low complexity region 481 491 N/A INTRINSIC
coiled coil region 596 641 N/A INTRINSIC
low complexity region 659 669 N/A INTRINSIC
low complexity region 701 719 N/A INTRINSIC
low complexity region 754 763 N/A INTRINSIC
low complexity region 979 994 N/A INTRINSIC
low complexity region 1153 1175 N/A INTRINSIC
low complexity region 1250 1267 N/A INTRINSIC
coiled coil region 1363 1402 N/A INTRINSIC
low complexity region 1517 1531 N/A INTRINSIC
low complexity region 1536 1546 N/A INTRINSIC
low complexity region 1694 1714 N/A INTRINSIC
coiled coil region 1732 1794 N/A INTRINSIC
low complexity region 1800 1811 N/A INTRINSIC
low complexity region 1819 1835 N/A INTRINSIC
coiled coil region 1853 1893 N/A INTRINSIC
low complexity region 1980 1994 N/A INTRINSIC
coiled coil region 2042 2092 N/A INTRINSIC
low complexity region 2383 2394 N/A INTRINSIC
low complexity region 2409 2421 N/A INTRINSIC
low complexity region 2470 2482 N/A INTRINSIC
CAP_GLY 2486 2551 5.91e-31 SMART
coiled coil region 2700 2731 N/A INTRINSIC
Meta Mutation Damage Score 0.4783 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a large protein with a CAP-Gly domain typically found in cytoskeleton-associated proteins. The encoded protein primarily localizes to the centrosome, a non-membraneous organelle that functions as the major microtubule-organizing center in animal cells. The encoded protein directly interacts with another large centrosomal protein and is required to anchor microtubules at the centrosome. It is also implicated in the regulation of a class of nuclear hormone receptors in the nucleus. Several alternatively spliced transcript variants have been found, but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI

 All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610021A01Rik T A 7: 41,626,125 C417* probably null Het
4930548G14Rik G A 15: 46,625,489 noncoding transcript Het
Abcc12 T A 8: 86,505,497 K1311* probably null Het
Abcc12 T C 8: 86,509,771 D1138G possibly damaging Het
Adam32 A G 8: 24,921,298 S116P probably damaging Het
Arhgef26 C T 3: 62,423,583 L39F probably damaging Het
Babam1 T C 8: 71,403,019 I252T probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Ccdc109b A T 3: 129,918,727 H166Q probably benign Het
Ccdc61 G T 7: 18,903,937 probably benign Het
Ccdc89 C T 7: 90,426,738 S52F probably damaging Het
Cds2 T A 2: 132,302,213 I320N possibly damaging Het
Cebpe T C 14: 54,711,942 Y6C probably damaging Het
Cep250 T A 2: 155,973,356 I598N probably damaging Het
Ces3a T C 8: 105,048,685 L22P probably damaging Het
Cfap221 T C 1: 119,945,828 S490G probably benign Het
Cyp2j11 A G 4: 96,319,376 V234A probably benign Het
Dgat1 T C 15: 76,502,729 H399R probably damaging Het
Dnah10 A T 5: 124,773,190 probably null Het
Ebpl T G 14: 61,341,207 K193T probably benign Het
Elmsan1 T C 12: 84,172,902 E426G probably damaging Het
Entpd5 T C 12: 84,396,771 N66S probably benign Het
Fcgbp G T 7: 28,101,249 G1240V possibly damaging Het
Gabra5 A G 7: 57,421,842 S209P probably benign Het
Glce A T 9: 62,070,533 V23D probably damaging Het
Gm14226 GACTGTTAC GAC 2: 155,024,931 probably benign Het
Gtf2h1 A G 7: 46,812,466 N296S probably null Het
Herc6 T C 6: 57,652,065 S654P probably benign Het
Kcnk3 A T 5: 30,621,977 M124L possibly damaging Het
Lamb2 T G 9: 108,481,928 V281G probably damaging Het
Lctl A T 9: 64,133,107 D444V probably damaging Het
Mcm2 A G 6: 88,884,044 F891L probably damaging Het
Mical2 G T 7: 112,333,836 R739L probably benign Het
Mkrn2 G T 6: 115,613,369 A229S probably damaging Het
Mmp7 A G 9: 7,695,277 Y80C possibly damaging Het
Mpp2 T C 11: 102,062,396 probably null Het
Msh6 C A 17: 87,985,722 T635K possibly damaging Het
Mvd T A 8: 122,436,547 T315S probably benign Het
Myocd C T 11: 65,218,521 probably benign Het
Nav1 C T 1: 135,458,389 probably null Het
Olfr1298 T A 2: 111,645,869 I43F probably damaging Het
Pde4b A T 4: 102,487,351 D141V probably damaging Het
Pdgfrb A T 18: 61,081,833 D978V possibly damaging Het
Prss55 T C 14: 64,075,680 T252A probably damaging Het
Psd3 A T 8: 68,120,839 V230E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptprn A G 1: 75,262,050 V82A probably damaging Het
Ptpru G T 4: 131,793,678 probably null Het
Raph1 T A 1: 60,519,024 K258* probably null Het
Rnf25 A G 1: 74,598,727 V28A probably damaging Het
Slc25a4 C T 8: 46,208,503 V212M probably benign Het
Slc39a3 T C 10: 81,031,508 S135G probably damaging Het
Slco6d1 A G 1: 98,428,372 I220M probably damaging Het
Smim19 G T 8: 22,473,528 Y21* probably null Het
Speer4f1 A C 5: 17,478,761 Y141S probably damaging Het
Srgap2 G A 1: 131,289,388 P1062L probably benign Het
Stra8 A T 6: 34,927,719 probably benign Het
Timm21 G C 18: 84,949,262 L130V probably damaging Het
Tmem40 A G 6: 115,738,999 S76P probably benign Het
Unc13b C T 4: 43,240,285 R3569W probably damaging Het
Vmn1r128 A T 7: 21,349,944 Q191L probably benign Het
Washc2 T A 6: 116,231,632 probably benign Het
Other mutations in Cep350
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00764:Cep350 APN 1 155940746 missense possibly damaging 0.68
IGL00821:Cep350 APN 1 155862204 missense probably benign
IGL00837:Cep350 APN 1 155953391 missense probably damaging 1.00
IGL00977:Cep350 APN 1 155932865 missense probably null 0.99
IGL01544:Cep350 APN 1 155953187 missense probably damaging 1.00
IGL01616:Cep350 APN 1 155953247 missense probably benign 0.00
IGL01695:Cep350 APN 1 155944158 missense probably damaging 1.00
IGL01902:Cep350 APN 1 155861985 missense probably damaging 1.00
IGL01977:Cep350 APN 1 155911968 missense probably benign 0.01
IGL02388:Cep350 APN 1 155953753 missense probably benign 0.28
IGL02475:Cep350 APN 1 155862595 missense probably damaging 1.00
IGL02528:Cep350 APN 1 155894615 missense probably damaging 1.00
IGL02598:Cep350 APN 1 155862967 missense probably benign 0.00
IGL02676:Cep350 APN 1 155862231 missense possibly damaging 0.82
IGL02728:Cep350 APN 1 155953222 missense probably benign 0.02
IGL02744:Cep350 APN 1 155931533 missense probably damaging 0.98
IGL02817:Cep350 APN 1 155928842 missense probably damaging 1.00
IGL02892:Cep350 APN 1 155868806 missense possibly damaging 0.51
IGL03156:Cep350 APN 1 155858042 missense probably damaging 1.00
IGL03166:Cep350 APN 1 155863600 missense possibly damaging 0.78
IGL03216:Cep350 APN 1 155860627 missense probably benign 0.06
IGL03268:Cep350 APN 1 155953549 missense probably benign 0.16
IGL03358:Cep350 APN 1 155928539 missense probably benign
primed UTSW 1 155953588 missense probably damaging 0.98
stoked UTSW 1 155915575 missense probably benign 0.03
NA:Cep350 UTSW 1 155958648 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0060:Cep350 UTSW 1 155928626 missense probably damaging 1.00
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0066:Cep350 UTSW 1 155911218 missense probably damaging 0.99
R0172:Cep350 UTSW 1 155953447 missense probably benign 0.00
R0365:Cep350 UTSW 1 155906571 missense probably benign 0.00
R0472:Cep350 UTSW 1 155914723 missense probably damaging 0.99
R0502:Cep350 UTSW 1 155900883 splice site probably null
R0538:Cep350 UTSW 1 155848620 missense possibly damaging 0.80
R0547:Cep350 UTSW 1 155901435 splice site probably null
R0565:Cep350 UTSW 1 155961195 splice site probably benign
R0607:Cep350 UTSW 1 155872048 missense probably damaging 1.00
R0645:Cep350 UTSW 1 155940712 splice site probably null
R0675:Cep350 UTSW 1 155959753 missense possibly damaging 0.63
R0828:Cep350 UTSW 1 155953246 missense probably benign 0.00
R0863:Cep350 UTSW 1 155862235 missense probably benign 0.00
R0969:Cep350 UTSW 1 155940826 missense possibly damaging 0.81
R1102:Cep350 UTSW 1 155931518 missense probably damaging 1.00
R1186:Cep350 UTSW 1 155875376 missense probably damaging 1.00
R1552:Cep350 UTSW 1 155910738 missense possibly damaging 0.92
R1560:Cep350 UTSW 1 155929079 missense possibly damaging 0.48
R1698:Cep350 UTSW 1 155953358 missense possibly damaging 0.62
R1729:Cep350 UTSW 1 155911981 missense probably benign 0.17
R1735:Cep350 UTSW 1 155953214 missense probably damaging 0.99
R1783:Cep350 UTSW 1 155928865 missense probably damaging 1.00
R1844:Cep350 UTSW 1 155848628 missense probably damaging 0.99
R1848:Cep350 UTSW 1 155953651 missense probably benign 0.28
R1988:Cep350 UTSW 1 155933104 missense possibly damaging 0.82
R2008:Cep350 UTSW 1 155914721 missense probably benign 0.16
R2241:Cep350 UTSW 1 155958556 splice site probably null
R2245:Cep350 UTSW 1 155879020 missense probably benign 0.10
R2402:Cep350 UTSW 1 155863136 missense probably benign
R2566:Cep350 UTSW 1 155959718 critical splice donor site probably null
R3160:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3162:Cep350 UTSW 1 155863164 missense probably benign 0.00
R3769:Cep350 UTSW 1 155953204 missense probably damaging 1.00
R4035:Cep350 UTSW 1 155959795 missense probably benign 0.06
R4158:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4160:Cep350 UTSW 1 155932875 missense probably damaging 1.00
R4213:Cep350 UTSW 1 155935961 missense probably damaging 1.00
R4483:Cep350 UTSW 1 155926468 missense probably benign 0.01
R4648:Cep350 UTSW 1 155902598 missense possibly damaging 0.85
R4694:Cep350 UTSW 1 155928586 missense probably damaging 1.00
R4836:Cep350 UTSW 1 155928833 missense probably damaging 1.00
R4839:Cep350 UTSW 1 155928494 missense probably benign 0.00
R4969:Cep350 UTSW 1 155860279 missense probably damaging 0.99
R5014:Cep350 UTSW 1 155928206 missense probably benign 0.00
R5027:Cep350 UTSW 1 155933354 missense probably benign 0.01
R5144:Cep350 UTSW 1 155911150 missense probably damaging 0.99
R5153:Cep350 UTSW 1 155935946 missense probably damaging 1.00
R5165:Cep350 UTSW 1 155928368 missense probably damaging 1.00
R5182:Cep350 UTSW 1 155858108 missense probably damaging 1.00
R5445:Cep350 UTSW 1 155894723 missense probably benign 0.01
R5738:Cep350 UTSW 1 155866078 missense probably damaging 1.00
R5809:Cep350 UTSW 1 155933341 missense probably damaging 0.98
R5855:Cep350 UTSW 1 155953762 missense probably benign 0.00
R6103:Cep350 UTSW 1 155924576 missense probably benign 0.05
R6139:Cep350 UTSW 1 155953279 missense probably benign 0.03
R6285:Cep350 UTSW 1 155953374 missense possibly damaging 0.48
R6430:Cep350 UTSW 1 155894673 missense probably damaging 1.00
R6446:Cep350 UTSW 1 155862154 missense probably benign
R6520:Cep350 UTSW 1 155933336 missense probably benign 0.02
R6712:Cep350 UTSW 1 155858106 missense possibly damaging 0.93
R6940:Cep350 UTSW 1 155928551 missense probably benign 0.01
R7020:Cep350 UTSW 1 155928331 missense probably damaging 1.00
R7056:Cep350 UTSW 1 155848627 missense probably damaging 1.00
R7141:Cep350 UTSW 1 155914748 missense probably damaging 1.00
R7215:Cep350 UTSW 1 155894707 missense possibly damaging 0.89
R7247:Cep350 UTSW 1 155910753 missense probably damaging 1.00
R7272:Cep350 UTSW 1 155953588 missense probably damaging 0.98
R7336:Cep350 UTSW 1 155862276 missense probably benign 0.17
R7361:Cep350 UTSW 1 155901491 missense probably damaging 1.00
R7390:Cep350 UTSW 1 155866087 missense possibly damaging 0.94
R7402:Cep350 UTSW 1 155928215 missense probably benign 0.00
R7428:Cep350 UTSW 1 155894619 missense probably benign 0.00
R7440:Cep350 UTSW 1 155940772 missense probably damaging 0.98
R7520:Cep350 UTSW 1 155915629 missense probably benign 0.05
R7529:Cep350 UTSW 1 155861923 missense probably benign 0.08
R7635:Cep350 UTSW 1 155879021 nonsense probably null
R7806:Cep350 UTSW 1 155862063 missense probably benign 0.00
R8100:Cep350 UTSW 1 155953402 missense probably damaging 0.97
R8192:Cep350 UTSW 1 155940783 missense possibly damaging 0.94
R8193:Cep350 UTSW 1 155862079 missense probably benign 0.01
R8351:Cep350 UTSW 1 155872034 missense probably damaging 0.99
R8406:Cep350 UTSW 1 155922418 missense probably benign 0.00
R8451:Cep350 UTSW 1 155872034 missense probably damaging 0.99
R8467:Cep350 UTSW 1 155915575 missense probably benign 0.03
R8543:Cep350 UTSW 1 155862376 missense probably damaging 0.98
R8714:Cep350 UTSW 1 155860731 missense probably damaging 0.98
R8810:Cep350 UTSW 1 155928116 missense probably damaging 1.00
R8837:Cep350 UTSW 1 155861772 missense probably benign 0.09
R8933:Cep350 UTSW 1 155863415 missense probably benign 0.01
RF020:Cep350 UTSW 1 155915478 missense probably benign 0.34
X0018:Cep350 UTSW 1 155953286 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- GACACACAGGTTCCCAGCATCTTC -3'
(R):5'- AGTTCACAGTTCTCAAGCCCAGC -3'

Sequencing Primer
(F):5'- ATCTTCTGAATCCGGGCAG -3'
(R):5'- CTGTTTTACCAGCCAAGAAGAGTC -3'
Posted On2014-05-23