Incidental Mutation 'R0088:Carnmt1'
ID20031
Institutional Source Beutler Lab
Gene Symbol Carnmt1
Ensembl Gene ENSMUSG00000024726
Gene Namecarnosine N-methyltransferase 1
Synonyms2410127L17Rik
MMRRC Submission 038375-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R0088 (G1)
Quality Score221
Status Validated (trace)
Chromosome19
Chromosomal Location18670780-18704788 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 18677853 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 123 (H123Q)
Ref Sequence ENSEMBL: ENSMUSP00000025632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025632]
Predicted Effect probably benign
Transcript: ENSMUST00000025632
AA Change: H123Q

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000025632
Gene: ENSMUSG00000024726
AA Change: H123Q

DomainStartEndE-ValueType
low complexity region 28 46 N/A INTRINSIC
N2227 135 400 2.56e-169 SMART
Meta Mutation Damage Score 0.1644 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 90.8%
Validation Efficiency 82% (32/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methyltransferase that converts carnosine to anserine, a dipeptide found abundantly in skeletal muscle. The encoded protein can methylate other dipeptides as well. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam32 T C 8: 24,914,067 K243R probably damaging Het
Akap9 C A 5: 3,961,946 T883K probably benign Het
Arhgap5 G T 12: 52,516,548 D101Y probably damaging Het
Bnc1 T G 7: 81,978,498 N39T possibly damaging Het
Cdh24 T C 14: 54,633,714 D92G probably damaging Het
Eomes A G 9: 118,478,673 E5G probably damaging Het
Eqtn T C 4: 94,919,990 T192A probably damaging Het
Fam110c T C 12: 31,075,218 V393A probably damaging Het
Fbll1 C A 11: 35,798,140 A99S possibly damaging Het
Il1rl2 A T 1: 40,365,053 I445F possibly damaging Het
Ipo8 T C 6: 148,801,936 T400A probably benign Het
Iqsec3 T C 6: 121,473,289 E92G probably damaging Het
Itpr2 C T 6: 146,241,185 V1679M probably benign Het
Kif2a G A 13: 106,975,432 A478V probably damaging Het
Lingo4 A G 3: 94,402,033 S93G probably benign Het
Mrpl37 A G 4: 107,064,424 S203P possibly damaging Het
Ndel1 A C 11: 68,833,420 S242R probably damaging Het
Nfatc3 T A 8: 106,127,942 M1036K possibly damaging Het
Ngrn T C 7: 80,264,455 I118T probably damaging Het
Olfr975 A G 9: 39,950,375 V132A probably benign Het
Pex10 A T 4: 155,070,498 S236C probably damaging Het
Phkb T G 8: 85,942,391 probably null Het
Pklr A G 3: 89,141,908 Y187C probably damaging Het
Plekhh1 A C 12: 79,055,366 E403D probably benign Het
Pls1 T C 9: 95,795,768 K22E possibly damaging Het
Prdm2 G A 4: 143,134,954 H589Y possibly damaging Het
Rabggtb C A 3: 153,908,830 R230L probably damaging Het
Rsph4a A G 10: 33,909,353 E420G probably benign Het
Sdk2 T C 11: 113,827,086 N1484S possibly damaging Het
St8sia3 T A 18: 64,266,985 V17E possibly damaging Het
Sult6b2 T A 6: 142,797,949 N117I probably damaging Het
Thbs2 T C 17: 14,681,701 T422A possibly damaging Het
Tmem266 A G 9: 55,437,329 D415G probably damaging Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Ttyh2 G T 11: 114,690,255 G107C probably damaging Het
Ubr4 A G 4: 139,440,814 D2835G probably damaging Het
Zranb3 T C 1: 127,976,462 D540G probably benign Het
Other mutations in Carnmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00684:Carnmt1 APN 19 18703382 missense possibly damaging 0.92
IGL01347:Carnmt1 APN 19 18691454 missense probably benign 0.21
R1929:Carnmt1 UTSW 19 18703370 missense probably damaging 1.00
R2270:Carnmt1 UTSW 19 18703370 missense probably damaging 1.00
R2271:Carnmt1 UTSW 19 18703370 missense probably damaging 1.00
R2272:Carnmt1 UTSW 19 18703370 missense probably damaging 1.00
R2519:Carnmt1 UTSW 19 18693711 missense probably benign 0.41
R4597:Carnmt1 UTSW 19 18671087 missense probably damaging 1.00
R5030:Carnmt1 UTSW 19 18691586 missense possibly damaging 0.82
R5114:Carnmt1 UTSW 19 18677734 missense probably damaging 1.00
R5933:Carnmt1 UTSW 19 18704105 missense probably benign 0.00
R7262:Carnmt1 UTSW 19 18677864 missense probably benign 0.33
R7394:Carnmt1 UTSW 19 18670837 start gained probably benign
X0024:Carnmt1 UTSW 19 18677704 nonsense probably null
X0065:Carnmt1 UTSW 19 18690309 missense probably benign 0.00
Z1176:Carnmt1 UTSW 19 18679213 missense possibly damaging 0.65
Z1176:Carnmt1 UTSW 19 18704090 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GTCCAGCAGGACTTCGGAATAACAG -3'
(R):5'- TCTAGCATGGTGTTCACCCAGCTC -3'

Sequencing Primer
(F):5'- CAGTTATGCAAGCTGACAGTC -3'
(R):5'- GTTCACCCAGCTCCCCAG -3'
Posted On2013-04-11