Mutagenetix > Incidental Mutation

Incidental Mutation 'R1741:Gpr158'

200317

Institutional Source

Beutler Lab

Gene Symbol

Gpr158

Ensembl Gene

ENSMUSG00000045967

Gene Name

G protein-coupled receptor 158

Synonyms

5330427M13Rik

MMRRC Submission

039773-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1741 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

21367542-21830547 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21827548 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 1153 (N1153S)

Ref Sequence

ENSEMBL: ENSMUSP00000049708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055946]

AlphaFold

Q8C419

Predicted Effect

probably benign
Transcript: ENSMUST00000055946
AA Change: N1153S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000049708
Gene: ENSMUSG00000045967
AA Change: N1153S

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
low complexity region	110	125	N/A	INTRINSIC
SCOP:d1edmb_	313	359	5e-4	SMART
Blast:EGF	318	365	2e-27	BLAST
Pfam:7tm_3	426	669	1.2e-35	PFAM
low complexity region	840	863	N/A	INTRINSIC

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.5%
20x: 92.9%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700034E13Rik	A	G	18: 52,660,506	N37S	probably damaging	Het
9530053A07Rik	G	T	7: 28,157,854	C2209F	probably damaging	Het
Acad10	T	C	5: 121,647,836	K230R	probably damaging	Het
Actl7a	A	G	4: 56,744,252	N260D	probably benign	Het
Adam24	T	C	8: 40,679,603	Y37H	probably benign	Het
Ahcy	G	A	2: 155,064,234	A229V	probably benign	Het
Ap3b2	A	G	7: 81,467,599	V563A	possibly damaging	Het
Bcl9l	T	A	9: 44,509,689	M1427K	probably damaging	Het
Btf3	C	T	13: 98,316,296	M1I	probably null	Het
Btg4	A	T	9: 51,116,610	I27L	probably benign	Het
Ccdc171	A	G	4: 83,620,839	Y366C	probably damaging	Het
Chd3	A	G	11: 69,355,654	Y1085H	probably damaging	Het
Cnot10	T	C	9: 114,597,824	D616G	possibly damaging	Het
Crlf1	C	A	8: 70,500,906	D243E	probably damaging	Het
Cyp2b23	A	G	7: 26,673,077	V371A	possibly damaging	Het
Dennd2a	A	G	6: 39,493,157	S534P	probably damaging	Het
Eln	A	G	5: 134,729,184	V185A	unknown	Het
Epor	C	T	9: 21,959,771	G301D	probably damaging	Het
Fam83f	T	G	15: 80,692,267	V373G	possibly damaging	Het
Fbxl21	A	T	13: 56,537,102	T340S	probably benign	Het
Fez1	T	A	9: 36,843,733	D9E	probably damaging	Het
Fsip2	T	C	2: 82,989,912	F5330L	probably benign	Het
Glis1	G	A	4: 107,568,347	R197Q	probably damaging	Het
Gm10277	TC	T	11: 77,786,002		probably null	Het
Gramd4	T	C	15: 86,091,529		probably null	Het
Hhatl	T	A	9: 121,789,059	Y210F	possibly damaging	Het
Hltf	T	C	3: 20,086,188	W422R	probably damaging	Het
Hspa5	T	C	2: 34,772,692	S87P	possibly damaging	Het
Il21	T	C	3: 37,227,662	H111R	probably benign	Het
Ip6k1	G	A	9: 108,040,984	G73S	probably benign	Het
Kdm5b	A	G	1: 134,618,017	D972G	possibly damaging	Het
Kif21b	C	T	1: 136,156,142	A709V	probably damaging	Het
Kmt2d	T	C	15: 98,845,234		probably benign	Het
Lrrc14b	A	G	13: 74,363,586	L125P	probably damaging	Het
Mapk8ip3	A	G	17: 24,899,854	S1169P	probably damaging	Het
Me3	A	T	7: 89,851,833	Y584F	probably damaging	Het
Mxra7	T	G	11: 116,816,244		probably null	Het
Nf1	T	C	11: 79,443,931	S870P	probably benign	Het
Npr2	G	A	4: 43,643,350	G525S	probably damaging	Het
Nyap1	A	T	5: 137,733,125	S726T	probably damaging	Het
Padi4	A	G	4: 140,746,170	V652A	probably damaging	Het
Pclo	A	G	5: 14,676,510		probably benign	Het
Pgm2	G	A	4: 99,964,865		probably null	Het
Piezo2	A	G	18: 63,021,173	S2512P	probably damaging	Het
Ptbp3	A	T	4: 59,482,624	D386E	probably damaging	Het
Ptk2	A	G	15: 73,242,406	V701A	possibly damaging	Het
Ptpn3	A	G	4: 57,254,922	V154A	probably damaging	Het
Rassf4	T	C	6: 116,639,489	E287G	probably damaging	Het
Rnh1	C	T	7: 141,164,023	R174H	probably benign	Het
Scn9a	T	A	2: 66,487,594	I1517F	probably damaging	Het
Sftpb	C	A	6: 72,305,813	A90E	probably benign	Het
Slc39a14	T	C	14: 70,318,744	K61R	probably damaging	Het
Tmem132d	A	C	5: 127,784,858	M733R	probably benign	Het
Tmem248	A	G	5: 130,236,823	I156V	probably benign	Het
Traf2	T	C	2: 25,524,483	D339G	probably damaging	Het
Trappc11	A	G	8: 47,529,327		probably null	Het
Tuba8	T	A	6: 121,222,768	I137N	possibly damaging	Het
Txlnb	A	G	10: 17,838,947	T376A	probably damaging	Het
Usp34	A	G	11: 23,364,103	T663A	probably benign	Het
Vmn2r26	T	A	6: 124,061,472	F669I	probably damaging	Het
Wdr95	G	A	5: 149,595,396		probably null	Het
Wfdc8	T	G	2: 164,608,869		probably benign	Het
Zfp64	A	C	2: 168,926,318	V458G	probably benign	Het
Zfp868	C	T	8: 69,611,868	G272D	probably damaging	Het

Other mutations in Gpr158

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00340:Gpr158	APN	2	21368683	missense	probably damaging	1.00
IGL00469:Gpr158	APN	2	21746795	splice site	probably benign
IGL00706:Gpr158	APN	2	21746773	missense	probably damaging	1.00
IGL00780:Gpr158	APN	2	21826818	nonsense	probably null
IGL00885:Gpr158	APN	2	21649021	missense	probably damaging	1.00
IGL01339:Gpr158	APN	2	21369031	missense	possibly damaging	0.73
IGL01368:Gpr158	APN	2	21827098	missense	probably damaging	1.00
IGL02141:Gpr158	APN	2	21783290	missense	probably damaging	0.99
IGL02455:Gpr158	APN	2	21368700	missense	probably benign	0.00
IGL02554:Gpr158	APN	2	21826596	missense	probably benign
IGL02681:Gpr158	APN	2	21815630	missense	probably damaging	1.00
IGL02752:Gpr158	APN	2	21826827	missense	possibly damaging	0.95
IGL02756:Gpr158	APN	2	21827079	missense	possibly damaging	0.47
IGL03181:Gpr158	APN	2	21783161	missense	probably benign	0.02
IGL03258:Gpr158	APN	2	21825274	missense	probably damaging	1.00
IGL03386:Gpr158	APN	2	21826246	missense	probably damaging	1.00
PIT4810001:Gpr158	UTSW	2	21826871	missense	probably benign	0.01
R0071:Gpr158	UTSW	2	21810668	missense	probably benign	0.08
R0081:Gpr158	UTSW	2	21826717	missense	probably damaging	1.00
R0528:Gpr158	UTSW	2	21825208	missense	probably damaging	1.00
R0560:Gpr158	UTSW	2	21825274	missense	probably damaging	1.00
R0603:Gpr158	UTSW	2	21815669	missense	possibly damaging	0.67
R1560:Gpr158	UTSW	2	21826314	missense	probably damaging	1.00
R1561:Gpr158	UTSW	2	21815694	splice site	probably null
R1609:Gpr158	UTSW	2	21783293	missense	possibly damaging	0.61
R1827:Gpr158	UTSW	2	21827318	missense	probably benign
R1854:Gpr158	UTSW	2	21369124	missense	probably damaging	1.00
R1871:Gpr158	UTSW	2	21815615	missense	probably damaging	1.00
R2151:Gpr158	UTSW	2	21827514	missense	possibly damaging	0.82
R2273:Gpr158	UTSW	2	21826863	missense	probably benign
R2275:Gpr158	UTSW	2	21826863	missense	probably benign
R3004:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R3151:Gpr158	UTSW	2	21576960	missense	possibly damaging	0.68
R3943:Gpr158	UTSW	2	21368559	missense	possibly damaging	0.65
R4238:Gpr158	UTSW	2	21368551	missense	probably damaging	1.00
R4379:Gpr158	UTSW	2	21825214	missense	probably damaging	1.00
R4381:Gpr158	UTSW	2	21827592	missense	probably damaging	1.00
R4464:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4467:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4496:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4506:Gpr158	UTSW	2	21826999	missense	probably damaging	0.99
R4530:Gpr158	UTSW	2	21369000	missense	probably benign	0.03
R4646:Gpr158	UTSW	2	21827053	missense	probably benign
R4798:Gpr158	UTSW	2	21783182	missense	probably damaging	1.00
R4882:Gpr158	UTSW	2	21825248	missense	probably damaging	0.98
R4943:Gpr158	UTSW	2	21827157	missense	probably damaging	1.00
R5334:Gpr158	UTSW	2	21827505	missense	probably benign	0.01
R5560:Gpr158	UTSW	2	21826290	missense	possibly damaging	0.67
R5600:Gpr158	UTSW	2	21827235	missense	probably benign
R5637:Gpr158	UTSW	2	21783272	missense	probably benign	0.00
R5701:Gpr158	UTSW	2	21746709	missense	probably damaging	1.00
R5744:Gpr158	UTSW	2	21368520	missense	probably damaging	1.00
R5911:Gpr158	UTSW	2	21369121	missense	possibly damaging	0.95
R5991:Gpr158	UTSW	2	21368508	missense	probably damaging	0.99
R6200:Gpr158	UTSW	2	21399416	missense	probably damaging	0.97
R6306:Gpr158	UTSW	2	21815611	missense	possibly damaging	0.84
R6324:Gpr158	UTSW	2	21810554	missense	probably damaging	1.00
R6384:Gpr158	UTSW	2	21826288	missense	probably damaging	1.00
R6698:Gpr158	UTSW	2	21827110	missense	probably damaging	1.00
R6997:Gpr158	UTSW	2	21648991	missense	possibly damaging	0.46
R7086:Gpr158	UTSW	2	21826575	missense	probably benign	0.01
R7175:Gpr158	UTSW	2	21368302	missense	probably benign	0.13
R7197:Gpr158	UTSW	2	21810601	missense	probably damaging	0.99
R7293:Gpr158	UTSW	2	21576939	missense	possibly damaging	0.47
R7427:Gpr158	UTSW	2	21827318	missense	probably benign
R7515:Gpr158	UTSW	2	21368281	missense	probably damaging	1.00
R7730:Gpr158	UTSW	2	21826347	missense	probably damaging	1.00
R8122:Gpr158	UTSW	2	21826863	missense	probably benign
R8311:Gpr158	UTSW	2	21368890	missense	probably benign	0.00
R8754:Gpr158	UTSW	2	21576882	missense	probably benign	0.00
R8782:Gpr158	UTSW	2	21399338	missense	probably damaging	1.00
R8792:Gpr158	UTSW	2	21553326	missense	probably damaging	1.00
R8842:Gpr158	UTSW	2	21576940	missense	possibly damaging	0.88
R9009:Gpr158	UTSW	2	21576949	missense	probably damaging	1.00
R9102:Gpr158	UTSW	2	21825267	missense	probably damaging	1.00
R9150:Gpr158	UTSW	2	21826440	missense	probably benign	0.17
R9254:Gpr158	UTSW	2	21368231	start gained	probably benign
R9317:Gpr158	UTSW	2	21827226	missense	probably benign
R9379:Gpr158	UTSW	2	21368231	start gained	probably benign
R9428:Gpr158	UTSW	2	21783161	missense	probably benign
R9497:Gpr158	UTSW	2	21827014	missense	probably benign	0.00
R9667:Gpr158	UTSW	2	21825243	missense	probably damaging	0.99
R9681:Gpr158	UTSW	2	21826504	missense	probably damaging	0.99
X0062:Gpr158	UTSW	2	21826369	missense	probably damaging	1.00
Z1176:Gpr158	UTSW	2	21810690	critical splice donor site	probably null
Z1177:Gpr158	UTSW	2	21827272	missense	possibly damaging	0.46

Predicted Primers

PCR Primer
(F):5'- GGAGAATGGAAGCCAGCTCTACAC -3'
(R):5'- GGCAGAGTCAGCCTTCCTTCTTATG -3'

Sequencing Primer
(F):5'- CAACCAATATGTGTGCTGGGC -3'
(R):5'- CTAGGCTAACAAAGATGCCTTG -3'

Posted On

2014-05-23