Incidental Mutation 'R1741:Hspa5'
ID200320
Institutional Source Beutler Lab
Gene Symbol Hspa5
Ensembl Gene ENSMUSG00000026864
Gene Nameheat shock protein 5
SynonymsBip, 78kDa, Sez7, Grp78, D2Wsu141e, D2Wsu17e, Hsce70, XAP-1 antigen, mBiP, baffled
MMRRC Submission 039773-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1741 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34771970-34777547 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34772692 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 87 (S87P)
Ref Sequence ENSEMBL: ENSMUSP00000097747 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028222] [ENSMUST00000100171] [ENSMUST00000137145] [ENSMUST00000145903]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028222
AA Change: S87P

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028222
Gene: ENSMUSG00000026864
AA Change: S87P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:HSP70 31 637 8.2e-276 PFAM
Pfam:MreB_Mbl 136 406 1.2e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100171
AA Change: S87P

PolyPhen 2 Score 0.911 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000097747
Gene: ENSMUSG00000026864
AA Change: S87P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:HSP70 31 637 3.3e-278 PFAM
Pfam:MreB_Mbl 136 406 1.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129333
Predicted Effect probably benign
Transcript: ENSMUST00000137145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145466
Predicted Effect probably benign
Transcript: ENSMUST00000145903
SMART Domains Protein: ENSMUSP00000122360
Gene: ENSMUSG00000070953

DomainStartEndE-ValueType
Pfam:Kelch_2 38 90 1.5e-17 PFAM
Pfam:Kelch_4 38 90 2.2e-7 PFAM
Pfam:Kelch_1 55 87 4.5e-7 PFAM
Pfam:Kelch_3 107 155 7e-10 PFAM
Pfam:Kelch_4 146 199 4e-7 PFAM
Pfam:Kelch_3 157 209 1.5e-10 PFAM
Pfam:Kelch_5 197 231 1e-8 PFAM
Pfam:Kelch_4 200 249 3.4e-9 PFAM
Pfam:Kelch_5 247 284 5.1e-8 PFAM
Pfam:Kelch_1 250 292 2.9e-9 PFAM
Pfam:Kelch_6 250 301 1.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155595
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the heat shock protein 70 (HSP70) family. It is localized in the lumen of the endoplasmic reticulum (ER), and is involved in the folding and assembly of proteins in the ER. As this protein interacts with many ER proteins, it may play a key role in monitoring protein transport through the cell.[provided by RefSeq, Sep 2010]
PHENOTYPE: Nullizygous embryos die around implantation. Neonates homozygous for a knock-in allele die of respiratory failure. Mice homozygous for an ENU-induced mutation exhibit abnormal thalamocortical axon patterning, small kidneys, cleft palate, respiratory distress, and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Scn9a T A 2: 66,487,594 I1517F probably damaging Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Hspa5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01925:Hspa5 APN 2 34774718 missense probably benign
IGL01997:Hspa5 APN 2 34772315 utr 5 prime probably benign
IGL02239:Hspa5 APN 2 34772776 missense probably benign 0.00
IGL03326:Hspa5 APN 2 34776117 unclassified probably benign
R0281:Hspa5 UTSW 2 34774320 missense probably damaging 1.00
R1052:Hspa5 UTSW 2 34775098 missense probably damaging 0.99
R1687:Hspa5 UTSW 2 34775824 missense probably benign 0.00
R1833:Hspa5 UTSW 2 34776053 nonsense probably null
R1842:Hspa5 UTSW 2 34775803 missense probably damaging 1.00
R1851:Hspa5 UTSW 2 34774678 missense possibly damaging 0.64
R1864:Hspa5 UTSW 2 34774541 missense probably damaging 0.99
R1865:Hspa5 UTSW 2 34774541 missense probably damaging 0.99
R2173:Hspa5 UTSW 2 34774662 missense probably damaging 1.00
R5027:Hspa5 UTSW 2 34775815 missense probably damaging 1.00
R5889:Hspa5 UTSW 2 34774617 missense probably damaging 1.00
R6046:Hspa5 UTSW 2 34775749 missense possibly damaging 0.94
R6515:Hspa5 UTSW 2 34772404 missense probably benign 0.05
R7045:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7046:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7047:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7049:Hspa5 UTSW 2 34773192 missense probably damaging 0.99
R7185:Hspa5 UTSW 2 34775126 missense probably damaging 1.00
R7238:Hspa5 UTSW 2 34772371 missense unknown
X0067:Hspa5 UTSW 2 34775101 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTGGTAAGTGGTATCCGTCGAAG -3'
(R):5'- TGGTTTGCCCACCTCCAATATCAAC -3'

Sequencing Primer
(F):5'- GTGAGAAAGTGAGGTGCTGATTC -3'
(R):5'- GAACTTGATGTCCTGCTGCA -3'
Posted On2014-05-23