Incidental Mutation 'R1741:Scn9a'
ID 200321
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Name sodium channel, voltage-gated, type IX, alpha
Synonyms PN1
MMRRC Submission 039773-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1741 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 66480080-66634962 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 66487594 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1517 (I1517F)
Ref Sequence ENSEMBL: ENSMUSP00000126528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
AlphaFold Q62205
Predicted Effect probably damaging
Transcript: ENSMUST00000100063
AA Change: I1508F

PolyPhen 2 Score 0.968 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: I1508F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100064
AA Change: I1517F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: I1517F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112354
AA Change: I1506F

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: I1506F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152740
Predicted Effect probably damaging
Transcript: ENSMUST00000164384
AA Change: I1517F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: I1517F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000169900
AA Change: I1506F

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: I1506F

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700034E13Rik A G 18: 52,660,506 N37S probably damaging Het
9530053A07Rik G T 7: 28,157,854 C2209F probably damaging Het
Acad10 T C 5: 121,647,836 K230R probably damaging Het
Actl7a A G 4: 56,744,252 N260D probably benign Het
Adam24 T C 8: 40,679,603 Y37H probably benign Het
Ahcy G A 2: 155,064,234 A229V probably benign Het
Ap3b2 A G 7: 81,467,599 V563A possibly damaging Het
Bcl9l T A 9: 44,509,689 M1427K probably damaging Het
Btf3 C T 13: 98,316,296 M1I probably null Het
Btg4 A T 9: 51,116,610 I27L probably benign Het
Ccdc171 A G 4: 83,620,839 Y366C probably damaging Het
Chd3 A G 11: 69,355,654 Y1085H probably damaging Het
Cnot10 T C 9: 114,597,824 D616G possibly damaging Het
Crlf1 C A 8: 70,500,906 D243E probably damaging Het
Cyp2b23 A G 7: 26,673,077 V371A possibly damaging Het
Dennd2a A G 6: 39,493,157 S534P probably damaging Het
Eln A G 5: 134,729,184 V185A unknown Het
Epor C T 9: 21,959,771 G301D probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fbxl21 A T 13: 56,537,102 T340S probably benign Het
Fez1 T A 9: 36,843,733 D9E probably damaging Het
Fsip2 T C 2: 82,989,912 F5330L probably benign Het
Glis1 G A 4: 107,568,347 R197Q probably damaging Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gpr158 A G 2: 21,827,548 N1153S probably benign Het
Gramd4 T C 15: 86,091,529 probably null Het
Hhatl T A 9: 121,789,059 Y210F possibly damaging Het
Hltf T C 3: 20,086,188 W422R probably damaging Het
Hspa5 T C 2: 34,772,692 S87P possibly damaging Het
Il21 T C 3: 37,227,662 H111R probably benign Het
Ip6k1 G A 9: 108,040,984 G73S probably benign Het
Kdm5b A G 1: 134,618,017 D972G possibly damaging Het
Kif21b C T 1: 136,156,142 A709V probably damaging Het
Kmt2d T C 15: 98,845,234 probably benign Het
Lrrc14b A G 13: 74,363,586 L125P probably damaging Het
Mapk8ip3 A G 17: 24,899,854 S1169P probably damaging Het
Me3 A T 7: 89,851,833 Y584F probably damaging Het
Mxra7 T G 11: 116,816,244 probably null Het
Nf1 T C 11: 79,443,931 S870P probably benign Het
Npr2 G A 4: 43,643,350 G525S probably damaging Het
Nyap1 A T 5: 137,733,125 S726T probably damaging Het
Padi4 A G 4: 140,746,170 V652A probably damaging Het
Pclo A G 5: 14,676,510 probably benign Het
Pgm2 G A 4: 99,964,865 probably null Het
Piezo2 A G 18: 63,021,173 S2512P probably damaging Het
Ptbp3 A T 4: 59,482,624 D386E probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpn3 A G 4: 57,254,922 V154A probably damaging Het
Rassf4 T C 6: 116,639,489 E287G probably damaging Het
Rnh1 C T 7: 141,164,023 R174H probably benign Het
Sftpb C A 6: 72,305,813 A90E probably benign Het
Slc39a14 T C 14: 70,318,744 K61R probably damaging Het
Tmem132d A C 5: 127,784,858 M733R probably benign Het
Tmem248 A G 5: 130,236,823 I156V probably benign Het
Traf2 T C 2: 25,524,483 D339G probably damaging Het
Trappc11 A G 8: 47,529,327 probably null Het
Tuba8 T A 6: 121,222,768 I137N possibly damaging Het
Txlnb A G 10: 17,838,947 T376A probably damaging Het
Usp34 A G 11: 23,364,103 T663A probably benign Het
Vmn2r26 T A 6: 124,061,472 F669I probably damaging Het
Wdr95 G A 5: 149,595,396 probably null Het
Wfdc8 T G 2: 164,608,869 probably benign Het
Zfp64 A C 2: 168,926,318 V458G probably benign Het
Zfp868 C T 8: 69,611,868 G272D probably damaging Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66563601 missense probably damaging 1.00
IGL00570:Scn9a APN 2 66484142 missense probably damaging 1.00
IGL00809:Scn9a APN 2 66483935 missense probably damaging 1.00
IGL00977:Scn9a APN 2 66484301 missense probably damaging 0.99
IGL01120:Scn9a APN 2 66526972 missense probably benign 0.00
IGL01134:Scn9a APN 2 66504968 missense probably damaging 1.00
IGL01300:Scn9a APN 2 66488053 nonsense probably null
IGL01452:Scn9a APN 2 66527072 missense probably damaging 1.00
IGL01531:Scn9a APN 2 66537378 missense probably benign 0.11
IGL01572:Scn9a APN 2 66493886 missense probably benign 0.00
IGL01645:Scn9a APN 2 66487642 missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66484042 missense probably damaging 1.00
IGL01965:Scn9a APN 2 66484433 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66547135 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66494826 missense probably damaging 1.00
IGL02166:Scn9a APN 2 66493103 missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66484611 splice site probably benign
IGL02640:Scn9a APN 2 66536096 critical splice donor site probably null
IGL02685:Scn9a APN 2 66537293 missense probably damaging 1.00
IGL02798:Scn9a APN 2 66540559 missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66568029 missense probably damaging 1.00
IGL03008:Scn9a APN 2 66562511 missense probably damaging 1.00
IGL03270:Scn9a APN 2 66484014 missense probably damaging 1.00
IGL03408:Scn9a APN 2 66526747 missense probably benign 0.00
BB007:Scn9a UTSW 2 66504849 missense probably damaging 0.99
BB017:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R0039:Scn9a UTSW 2 66562444 missense probably damaging 0.98
R0173:Scn9a UTSW 2 66533093 missense probably damaging 1.00
R0323:Scn9a UTSW 2 66568131 missense probably damaging 1.00
R0344:Scn9a UTSW 2 66505010 missense probably damaging 0.99
R0421:Scn9a UTSW 2 66543277 missense probably benign
R0465:Scn9a UTSW 2 66526996 missense probably damaging 1.00
R0514:Scn9a UTSW 2 66483678 missense probably damaging 1.00
R0599:Scn9a UTSW 2 66526799 missense probably damaging 0.96
R0627:Scn9a UTSW 2 66537377 missense probably benign 0.00
R0644:Scn9a UTSW 2 66533061 critical splice donor site probably null
R0653:Scn9a UTSW 2 66533377 missense probably damaging 1.00
R0685:Scn9a UTSW 2 66483499 missense probably benign 0.02
R0718:Scn9a UTSW 2 66547112 missense probably damaging 1.00
R0827:Scn9a UTSW 2 66536124 nonsense probably null
R0890:Scn9a UTSW 2 66483735 missense probably damaging 1.00
R1139:Scn9a UTSW 2 66504997 missense probably benign 0.02
R1385:Scn9a UTSW 2 66563542 missense probably damaging 1.00
R1398:Scn9a UTSW 2 66484586 missense probably benign 0.11
R1496:Scn9a UTSW 2 66526888 missense probably benign
R1511:Scn9a UTSW 2 66526813 missense probably benign 0.01
R1517:Scn9a UTSW 2 66505027 splice site probably benign
R1564:Scn9a UTSW 2 66484304 missense probably damaging 1.00
R1634:Scn9a UTSW 2 66488017 missense probably damaging 1.00
R1662:Scn9a UTSW 2 66483459 missense probably benign 0.00
R1695:Scn9a UTSW 2 66504876 nonsense probably null
R1709:Scn9a UTSW 2 66483506 missense probably damaging 1.00
R1755:Scn9a UTSW 2 66501716 missense probably benign 0.38
R1914:Scn9a UTSW 2 66566250 missense probably damaging 1.00
R1962:Scn9a UTSW 2 66484311 missense probably damaging 1.00
R1970:Scn9a UTSW 2 66515380 missense probably damaging 0.97
R2017:Scn9a UTSW 2 66515321 missense probably damaging 0.99
R2092:Scn9a UTSW 2 66533376 missense probably damaging 0.99
R2105:Scn9a UTSW 2 66568183 missense probably benign 0.25
R2114:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2115:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2128:Scn9a UTSW 2 66526654 missense probably damaging 1.00
R2157:Scn9a UTSW 2 66536325 missense probably damaging 1.00
R2162:Scn9a UTSW 2 66534229 missense probably damaging 0.98
R2350:Scn9a UTSW 2 66504968 missense probably damaging 1.00
R3694:Scn9a UTSW 2 66562405 missense probably benign
R3771:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3772:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3773:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3922:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66565054 intron probably benign
R4385:Scn9a UTSW 2 66484556 missense probably damaging 1.00
R4415:Scn9a UTSW 2 66526693 missense probably damaging 1.00
R4570:Scn9a UTSW 2 66483558 missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66547018 missense probably benign
R4783:Scn9a UTSW 2 66540623 missense probably benign 0.01
R4822:Scn9a UTSW 2 66483749 missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66551713 missense probably benign
R4908:Scn9a UTSW 2 66526743 missense probably benign 0.03
R4983:Scn9a UTSW 2 66566270 missense probably benign 0.02
R5047:Scn9a UTSW 2 66562480 missense probably damaging 1.00
R5100:Scn9a UTSW 2 66534119 missense probably damaging 1.00
R5140:Scn9a UTSW 2 66565167 missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66488043 missense probably damaging 1.00
R5557:Scn9a UTSW 2 66547103 missense probably damaging 0.99
R5582:Scn9a UTSW 2 66565029 intron probably benign
R6108:Scn9a UTSW 2 66484049 missense probably damaging 1.00
R6115:Scn9a UTSW 2 66563629 missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66487524 missense probably benign 0.00
R6261:Scn9a UTSW 2 66483896 missense probably damaging 1.00
R6335:Scn9a UTSW 2 66568264 start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66526963 missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66483502 missense probably benign 0.23
R6681:Scn9a UTSW 2 66563342 missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66568029 missense probably damaging 1.00
R7102:Scn9a UTSW 2 66549015 missense probably damaging 1.00
R7186:Scn9a UTSW 2 66534223 missense probably damaging 1.00
R7243:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R7311:Scn9a UTSW 2 66484404 missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66484587 missense probably benign
R7386:Scn9a UTSW 2 66540550 missense probably damaging 1.00
R7438:Scn9a UTSW 2 66547187 missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66533348 missense probably damaging 0.99
R7485:Scn9a UTSW 2 66534217 missense probably damaging 1.00
R7526:Scn9a UTSW 2 66483646 missense probably benign
R7617:Scn9a UTSW 2 66540549 missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66536236 missense probably benign 0.02
R7653:Scn9a UTSW 2 66527080 missense probably damaging 1.00
R7747:Scn9a UTSW 2 66484298 missense probably damaging 1.00
R7823:Scn9a UTSW 2 66483791 missense probably damaging 1.00
R7864:Scn9a UTSW 2 66484560 missense possibly damaging 0.73
R7890:Scn9a UTSW 2 66543112 missense probably benign 0.00
R7930:Scn9a UTSW 2 66504849 missense probably damaging 0.99
R7975:Scn9a UTSW 2 66484253 missense probably damaging 1.00
R8057:Scn9a UTSW 2 66515430 missense probably benign 0.06
R8145:Scn9a UTSW 2 66487410 missense probably damaging 1.00
R8163:Scn9a UTSW 2 66484401 missense probably damaging 1.00
R8165:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R8342:Scn9a UTSW 2 66536282 missense probably benign
R8345:Scn9a UTSW 2 66494622 missense probably damaging 0.96
R8464:Scn9a UTSW 2 66566281 missense probably damaging 0.99
R8467:Scn9a UTSW 2 66501671 missense probably damaging 1.00
R8698:Scn9a UTSW 2 66536284 missense probably benign 0.00
R8810:Scn9a UTSW 2 66501666 missense probably damaging 1.00
R8822:Scn9a UTSW 2 66540635 missense probably damaging 0.99
R8829:Scn9a UTSW 2 66483617 missense probably benign
R9009:Scn9a UTSW 2 66508583 missense probably damaging 1.00
R9038:Scn9a UTSW 2 66494803 missense probably damaging 1.00
R9126:Scn9a UTSW 2 66484400 missense probably damaging 1.00
R9205:Scn9a UTSW 2 66533313 missense probably damaging 1.00
R9300:Scn9a UTSW 2 66504892 missense probably benign 0.39
R9373:Scn9a UTSW 2 66483917 missense probably benign 0.00
R9404:Scn9a UTSW 2 66526696 missense probably benign 0.02
R9443:Scn9a UTSW 2 66565209 missense probably damaging 1.00
R9590:Scn9a UTSW 2 66483984 missense probably benign 0.05
R9612:Scn9a UTSW 2 66533364 missense probably damaging 1.00
R9617:Scn9a UTSW 2 66562465 missense probably damaging 1.00
R9717:Scn9a UTSW 2 66526658 missense probably benign
X0003:Scn9a UTSW 2 66508647 missense probably benign 0.02
X0062:Scn9a UTSW 2 66568077 missense probably damaging 1.00
Z1176:Scn9a UTSW 2 66540592 missense probably benign 0.00
Z1177:Scn9a UTSW 2 66494685 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GAGAGATCAGCTTCAGCACACACTC -3'
(R):5'- AAAACCAATTCCGAGGCCAGGG -3'

Sequencing Primer
(F):5'- CTCCCCAGTGAACAGGATGATG -3'
(R):5'- cacacacacacacgcac -3'
Posted On 2014-05-23